Incidental Mutation 'R1637:Tspear'
ID173256
Institutional Source Beutler Lab
Gene Symbol Tspear
Ensembl Gene ENSMUSG00000069581
Gene Namethrombospondin type laminin G domain and EAR repeats
SynonymsC330046G03Rik, ORF65
MMRRC Submission 039673-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R1637 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location77686569-77887021 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 77870419 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 341 (L341H)
Ref Sequence ENSEMBL: ENSMUSP00000090020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092366]
Predicted Effect possibly damaging
Transcript: ENSMUST00000092366
AA Change: L341H

PolyPhen 2 Score 0.480 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000090020
Gene: ENSMUSG00000069581
AA Change: L341H

DomainStartEndE-ValueType
Blast:TSPN 1 71 8e-40 BLAST
SCOP:d1c4ra_ 2 67 2e-7 SMART
low complexity region 190 200 N/A INTRINSIC
Pfam:EPTP 208 255 2.6e-22 PFAM
Pfam:EPTP 260 307 1.4e-21 PFAM
Pfam:EPTP 312 359 8.9e-14 PFAM
Pfam:EPTP 362 417 6.2e-13 PFAM
Pfam:EPTP 422 469 1.3e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000092368
SMART Domains Protein: ENSMUSP00000090022
Gene: ENSMUSG00000069581

DomainStartEndE-ValueType
TSPN 3 174 2.24e-5 SMART
LamG 34 173 1.09e-1 SMART
low complexity region 293 303 N/A INTRINSIC
Pfam:EPTP 311 357 3.4e-20 PFAM
Pfam:EPTP 362 409 4.9e-23 PFAM
Pfam:EPTP 414 461 3.1e-15 PFAM
Pfam:EPTP 464 519 2.2e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125241
Meta Mutation Damage Score 0.4945 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains a N-terminal thrombospondin-type laminin G domain and several tandem arranged epilepsy-associated repeats (EARs). A mutation in this gene is the cause of autosomal recessive deafness-98. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Dec 2012]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik T A 5: 109,738,992 H50L probably benign Het
A2m C A 6: 121,654,612 L623M probably benign Het
Agpat5 A G 8: 18,881,811 R316G probably benign Het
Ankrd39 G A 1: 36,539,492 Q151* probably null Het
Arl13b T C 16: 62,830,784 D30G probably damaging Het
Atpaf1 A G 4: 115,788,302 S123G probably benign Het
Bicra A G 7: 15,972,689 S1276P probably benign Het
Car1 T C 3: 14,777,786 I60V possibly damaging Het
Cnbd2 A G 2: 156,373,724 I411V probably damaging Het
Cyp2c37 A T 19: 40,001,982 K375* probably null Het
Cysrt1 T C 2: 25,239,285 I72V probably benign Het
Dock9 T A 14: 121,651,775 D312V possibly damaging Het
Ecd T C 14: 20,346,692 I42V probably damaging Het
Ercc5 A G 1: 44,167,534 T536A probably benign Het
Gjd2 A T 2: 114,011,308 Y229* probably null Het
Gramd1b A T 9: 40,304,538 probably null Het
Hcrtr2 T C 9: 76,232,999 T336A probably benign Het
Hjurp G A 1: 88,266,121 S279F probably benign Het
Ift140 C T 17: 25,025,634 L152F probably benign Het
Izumo1r A G 9: 14,901,809 C56R probably damaging Het
Kif7 T C 7: 79,702,837 E850G probably damaging Het
Larp4b C G 13: 9,151,097 T335S probably benign Het
Lmo7 A T 14: 101,880,832 R42S probably damaging Het
Lrrk2 T G 15: 91,734,058 L920R probably benign Het
Mapk8 G A 14: 33,410,962 R6C probably benign Het
Mpped1 C T 15: 83,791,990 probably benign Het
Myoc A G 1: 162,639,367 Y35C probably damaging Het
Ndufb8 C T 19: 44,555,035 M66I probably benign Het
Nkpd1 T C 7: 19,523,979 I411T probably benign Het
Nrxn3 A G 12: 89,354,468 N382S possibly damaging Het
Olfr1219 A T 2: 89,075,052 L13Q probably damaging Het
Olfr328 A T 11: 58,551,420 V273E possibly damaging Het
Pear1 T C 3: 87,756,753 E303G probably damaging Het
Plekhg4 T A 8: 105,381,781 M1047K probably benign Het
Pofut1 T G 2: 153,265,789 F268C probably damaging Het
Psrc1 G T 3: 108,385,293 S134I probably damaging Het
Slc6a2 A T 8: 92,981,990 I245F probably benign Het
Slc9a1 T C 4: 133,422,223 S787P probably benign Het
Sorcs3 T A 19: 48,748,359 probably null Het
Syne2 C A 12: 75,996,002 H3916N probably damaging Het
Taar6 A G 10: 23,985,181 S156P probably benign Het
Tnn A G 1: 160,147,600 F86L probably damaging Het
Ttll8 A G 15: 88,914,444 V696A probably benign Het
Utrn C A 10: 12,436,364 D616Y probably damaging Het
Vmn2r18 A T 5: 151,584,757 C301S probably damaging Het
Xdh T C 17: 73,900,578 Y928C probably benign Het
Zfand1 G A 3: 10,345,982 A104V probably benign Het
Other mutations in Tspear
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Tspear APN 10 77873236 missense probably benign 0.30
IGL01726:Tspear APN 10 77881287 intron probably benign
IGL02244:Tspear APN 10 77852856 unclassified probably benign
IGL02393:Tspear APN 10 77836573 missense probably damaging 1.00
IGL02502:Tspear APN 10 77852958 intron probably benign
IGL02653:Tspear APN 10 77706965 utr 3 prime probably benign
IGL03345:Tspear APN 10 77874882 splice site probably null
R0058:Tspear UTSW 10 77869631 missense probably benign 0.07
R0058:Tspear UTSW 10 77869631 missense probably benign 0.07
R0542:Tspear UTSW 10 77881087 missense probably benign 0.14
R1384:Tspear UTSW 10 77866332 missense probably benign 0.44
R1467:Tspear UTSW 10 77881192 missense probably damaging 1.00
R1467:Tspear UTSW 10 77881192 missense probably damaging 1.00
R1545:Tspear UTSW 10 77870419 missense possibly damaging 0.48
R1625:Tspear UTSW 10 77870499 missense probably benign 0.20
R1635:Tspear UTSW 10 77870419 missense possibly damaging 0.48
R1636:Tspear UTSW 10 77870419 missense possibly damaging 0.48
R1744:Tspear UTSW 10 77864884 unclassified probably null
R1749:Tspear UTSW 10 77869673 missense probably benign 0.00
R1768:Tspear UTSW 10 77875116 critical splice donor site probably null
R1774:Tspear UTSW 10 77873185 missense probably benign 0.01
R1791:Tspear UTSW 10 77870419 missense possibly damaging 0.48
R1892:Tspear UTSW 10 77870474 missense probably benign 0.00
R2014:Tspear UTSW 10 77875120 splice site probably benign
R2108:Tspear UTSW 10 77870419 missense possibly damaging 0.48
R2248:Tspear UTSW 10 77873269 missense probably damaging 1.00
R3038:Tspear UTSW 10 77886439 nonsense probably null
R4010:Tspear UTSW 10 77836476 intron probably benign
R4661:Tspear UTSW 10 77866329 missense probably benign 0.24
R4734:Tspear UTSW 10 77864695 missense probably damaging 0.99
R4789:Tspear UTSW 10 77866365 missense possibly damaging 0.63
R4804:Tspear UTSW 10 77776957 unclassified probably null
R4904:Tspear UTSW 10 77869655 missense possibly damaging 0.93
R4937:Tspear UTSW 10 77875043 missense probably damaging 0.98
R4956:Tspear UTSW 10 77864767 missense possibly damaging 0.86
R5590:Tspear UTSW 10 77870365 missense probably benign
R6344:Tspear UTSW 10 77875013 missense possibly damaging 0.95
R6629:Tspear UTSW 10 77870509 missense probably benign 0.08
R7611:Tspear UTSW 10 77881215 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGGAGCAGCATCCCTTTAATGAGC -3'
(R):5'- TTGACTTGCAGAGTGCGTAGGC -3'

Sequencing Primer
(F):5'- GCTCTGGGCATAGATAGGTC -3'
(R):5'- AGTGCGTAGGCAGTCCAAC -3'
Posted On2014-04-24