Incidental Mutation 'R1637:Dock9'
ID 173266
Institutional Source Beutler Lab
Gene Symbol Dock9
Ensembl Gene ENSMUSG00000025558
Gene Name dedicator of cytokinesis 9
Synonyms D14Wsu89e, B230309H04Rik, Zizimin1
MMRRC Submission 039673-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1637 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 121779458-122035249 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 121889187 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 312 (D312V)
Ref Sequence ENSEMBL: ENSMUSP00000097872 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040700] [ENSMUST00000100299] [ENSMUST00000212181] [ENSMUST00000212376]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000040700
AA Change: D310V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000047881
Gene: ENSMUSG00000025558
AA Change: D310V

DomainStartEndE-ValueType
Pfam:DUF3398 58 151 5.6e-36 PFAM
PH 172 280 1.38e-16 SMART
Blast:PH 297 372 4e-25 BLAST
Pfam:DOCK-C2 631 822 5.3e-51 PFAM
Pfam:DHR-2 1523 2068 2.1e-212 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000100299
AA Change: D312V

PolyPhen 2 Score 0.656 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000097872
Gene: ENSMUSG00000025558
AA Change: D312V

DomainStartEndE-ValueType
Pfam:DUF3398 58 153 1.5e-32 PFAM
PH 174 282 1.38e-16 SMART
Blast:PH 299 374 4e-25 BLAST
Pfam:DOCK-C2 632 825 1.3e-59 PFAM
low complexity region 1752 1763 N/A INTRINSIC
Pfam:Ded_cyto 1836 2013 2.4e-69 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000212181
AA Change: D310V

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000212376
AA Change: D324V

PolyPhen 2 Score 0.122 (Sensitivity: 0.93; Specificity: 0.86)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik T A 5: 109,886,858 (GRCm39) H50L probably benign Het
A2m C A 6: 121,631,571 (GRCm39) L623M probably benign Het
Agpat5 A G 8: 18,931,827 (GRCm39) R316G probably benign Het
Ankrd39 G A 1: 36,578,573 (GRCm39) Q151* probably null Het
Arl13b T C 16: 62,651,147 (GRCm39) D30G probably damaging Het
Atpaf1 A G 4: 115,645,499 (GRCm39) S123G probably benign Het
Bicra A G 7: 15,706,614 (GRCm39) S1276P probably benign Het
Car1 T C 3: 14,842,846 (GRCm39) I60V possibly damaging Het
Cnbd2 A G 2: 156,215,644 (GRCm39) I411V probably damaging Het
Cyp2c37 A T 19: 39,990,426 (GRCm39) K375* probably null Het
Cysrt1 T C 2: 25,129,297 (GRCm39) I72V probably benign Het
Ecd T C 14: 20,396,760 (GRCm39) I42V probably damaging Het
Ercc5 A G 1: 44,206,694 (GRCm39) T536A probably benign Het
Gjd2 A T 2: 113,841,789 (GRCm39) Y229* probably null Het
Gramd1b A T 9: 40,215,834 (GRCm39) probably null Het
Hcrtr2 T C 9: 76,140,281 (GRCm39) T336A probably benign Het
Hjurp G A 1: 88,193,843 (GRCm39) S279F probably benign Het
Ift140 C T 17: 25,244,608 (GRCm39) L152F probably benign Het
Izumo1r A G 9: 14,813,105 (GRCm39) C56R probably damaging Het
Kif7 T C 7: 79,352,585 (GRCm39) E850G probably damaging Het
Larp4b C G 13: 9,201,133 (GRCm39) T335S probably benign Het
Lmo7 A T 14: 102,118,268 (GRCm39) R42S probably damaging Het
Lrrk2 T G 15: 91,618,261 (GRCm39) L920R probably benign Het
Mapk8 G A 14: 33,132,919 (GRCm39) R6C probably benign Het
Mpped1 C T 15: 83,676,191 (GRCm39) probably benign Het
Myoc A G 1: 162,466,936 (GRCm39) Y35C probably damaging Het
Ndufb8 C T 19: 44,543,474 (GRCm39) M66I probably benign Het
Nkpd1 T C 7: 19,257,904 (GRCm39) I411T probably benign Het
Nrxn3 A G 12: 89,321,238 (GRCm39) N382S possibly damaging Het
Or2t47 A T 11: 58,442,246 (GRCm39) V273E possibly damaging Het
Or4c114 A T 2: 88,905,396 (GRCm39) L13Q probably damaging Het
Pear1 T C 3: 87,664,060 (GRCm39) E303G probably damaging Het
Plekhg4 T A 8: 106,108,413 (GRCm39) M1047K probably benign Het
Pofut1 T G 2: 153,107,709 (GRCm39) F268C probably damaging Het
Psrc1 G T 3: 108,292,609 (GRCm39) S134I probably damaging Het
Slc6a2 A T 8: 93,708,618 (GRCm39) I245F probably benign Het
Slc9a1 T C 4: 133,149,534 (GRCm39) S787P probably benign Het
Sorcs3 T A 19: 48,736,798 (GRCm39) probably null Het
Syne2 C A 12: 76,042,776 (GRCm39) H3916N probably damaging Het
Taar6 A G 10: 23,861,079 (GRCm39) S156P probably benign Het
Tnn A G 1: 159,975,170 (GRCm39) F86L probably damaging Het
Tspear T A 10: 77,706,253 (GRCm39) L341H possibly damaging Het
Ttll8 A G 15: 88,798,647 (GRCm39) V696A probably benign Het
Utrn C A 10: 12,312,108 (GRCm39) D616Y probably damaging Het
Vmn2r18 A T 5: 151,508,222 (GRCm39) C301S probably damaging Het
Xdh T C 17: 74,207,573 (GRCm39) Y928C probably benign Het
Zfand1 G A 3: 10,411,042 (GRCm39) A104V probably benign Het
Other mutations in Dock9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Dock9 APN 14 121,905,880 (GRCm39) missense probably benign 0.12
IGL00817:Dock9 APN 14 121,935,703 (GRCm39) missense probably damaging 0.96
IGL00923:Dock9 APN 14 121,844,504 (GRCm39) unclassified probably benign
IGL01385:Dock9 APN 14 121,817,995 (GRCm39) missense possibly damaging 0.94
IGL01567:Dock9 APN 14 121,890,496 (GRCm39) missense probably damaging 1.00
IGL01767:Dock9 APN 14 121,860,282 (GRCm39) missense possibly damaging 0.91
IGL01811:Dock9 APN 14 121,796,440 (GRCm39) missense probably damaging 1.00
IGL02512:Dock9 APN 14 121,856,950 (GRCm39) splice site probably benign
IGL02525:Dock9 APN 14 121,877,538 (GRCm39) missense probably damaging 1.00
IGL02550:Dock9 APN 14 121,935,724 (GRCm39) start codon destroyed probably null 0.07
IGL02559:Dock9 APN 14 121,862,559 (GRCm39) splice site probably benign
IGL02666:Dock9 APN 14 121,818,111 (GRCm39) missense probably benign 0.42
IGL02674:Dock9 APN 14 121,833,023 (GRCm39) splice site probably null
IGL02795:Dock9 APN 14 121,877,390 (GRCm39) missense probably benign 0.04
IGL03074:Dock9 APN 14 121,844,682 (GRCm39) missense possibly damaging 0.95
IGL03095:Dock9 APN 14 121,876,940 (GRCm39) missense probably damaging 1.00
IGL03294:Dock9 APN 14 121,879,035 (GRCm39) splice site probably benign
R0036:Dock9 UTSW 14 121,860,265 (GRCm39) missense probably damaging 1.00
R0050:Dock9 UTSW 14 121,844,637 (GRCm39) missense probably benign 0.43
R0050:Dock9 UTSW 14 121,844,637 (GRCm39) missense probably benign 0.43
R0164:Dock9 UTSW 14 121,835,077 (GRCm39) missense probably damaging 1.00
R0164:Dock9 UTSW 14 121,835,077 (GRCm39) missense probably damaging 1.00
R0270:Dock9 UTSW 14 121,813,411 (GRCm39) missense probably benign 0.02
R0494:Dock9 UTSW 14 121,899,996 (GRCm39) missense possibly damaging 0.64
R0726:Dock9 UTSW 14 121,889,180 (GRCm39) nonsense probably null
R1029:Dock9 UTSW 14 121,837,096 (GRCm39) splice site probably null
R1214:Dock9 UTSW 14 121,823,728 (GRCm39) missense probably benign 0.02
R1231:Dock9 UTSW 14 121,813,362 (GRCm39) missense possibly damaging 0.61
R1535:Dock9 UTSW 14 121,783,476 (GRCm39) missense probably damaging 1.00
R1629:Dock9 UTSW 14 121,780,986 (GRCm39) missense possibly damaging 0.88
R1733:Dock9 UTSW 14 121,864,292 (GRCm39) missense probably benign 0.01
R1772:Dock9 UTSW 14 121,847,210 (GRCm39) missense probably benign 0.07
R1855:Dock9 UTSW 14 121,877,571 (GRCm39) missense probably damaging 1.00
R1888:Dock9 UTSW 14 121,862,617 (GRCm39) missense probably benign 0.18
R1888:Dock9 UTSW 14 121,862,617 (GRCm39) missense probably benign 0.18
R1901:Dock9 UTSW 14 121,862,565 (GRCm39) splice site probably null
R1920:Dock9 UTSW 14 121,820,792 (GRCm39) missense probably damaging 1.00
R1987:Dock9 UTSW 14 121,829,242 (GRCm39) missense probably benign 0.00
R3035:Dock9 UTSW 14 121,844,249 (GRCm39) missense possibly damaging 0.60
R3851:Dock9 UTSW 14 121,866,498 (GRCm39) splice site probably null
R4020:Dock9 UTSW 14 121,844,267 (GRCm39) missense probably benign 0.00
R4021:Dock9 UTSW 14 121,864,324 (GRCm39) missense possibly damaging 0.80
R4089:Dock9 UTSW 14 121,820,883 (GRCm39) missense probably damaging 1.00
R4258:Dock9 UTSW 14 121,818,854 (GRCm39) missense probably benign 0.00
R4423:Dock9 UTSW 14 121,799,465 (GRCm39) critical splice donor site probably null
R4561:Dock9 UTSW 14 121,796,419 (GRCm39) missense probably benign 0.01
R4604:Dock9 UTSW 14 121,905,871 (GRCm39) missense probably damaging 1.00
R4646:Dock9 UTSW 14 121,823,658 (GRCm39) missense probably damaging 1.00
R4647:Dock9 UTSW 14 121,823,658 (GRCm39) missense probably damaging 1.00
R4776:Dock9 UTSW 14 121,847,509 (GRCm39) missense possibly damaging 0.81
R4809:Dock9 UTSW 14 121,784,008 (GRCm39) missense probably benign 0.37
R4865:Dock9 UTSW 14 121,780,917 (GRCm39) makesense probably null
R4951:Dock9 UTSW 14 121,890,547 (GRCm39) missense probably benign 0.35
R5151:Dock9 UTSW 14 121,815,582 (GRCm39) missense probably damaging 1.00
R5359:Dock9 UTSW 14 121,890,472 (GRCm39) missense possibly damaging 0.69
R5366:Dock9 UTSW 14 121,815,615 (GRCm39) missense probably damaging 1.00
R5502:Dock9 UTSW 14 121,847,594 (GRCm39) splice site probably null
R5579:Dock9 UTSW 14 121,837,107 (GRCm39) missense probably damaging 1.00
R5753:Dock9 UTSW 14 121,872,037 (GRCm39) missense probably benign 0.05
R5836:Dock9 UTSW 14 121,918,763 (GRCm39) missense probably damaging 1.00
R5858:Dock9 UTSW 14 121,866,204 (GRCm39) missense probably benign 0.00
R5890:Dock9 UTSW 14 121,905,820 (GRCm39) critical splice donor site probably null
R6075:Dock9 UTSW 14 121,783,385 (GRCm39) missense probably benign
R6298:Dock9 UTSW 14 121,872,006 (GRCm39) missense probably damaging 1.00
R6306:Dock9 UTSW 14 121,799,492 (GRCm39) missense probably damaging 1.00
R6321:Dock9 UTSW 14 121,783,433 (GRCm39) missense probably damaging 1.00
R6330:Dock9 UTSW 14 121,842,655 (GRCm39) start codon destroyed probably null 0.00
R6719:Dock9 UTSW 14 121,847,439 (GRCm39) missense probably damaging 1.00
R6784:Dock9 UTSW 14 121,780,926 (GRCm39) missense probably damaging 1.00
R6826:Dock9 UTSW 14 121,860,330 (GRCm39) missense probably damaging 1.00
R6830:Dock9 UTSW 14 121,860,330 (GRCm39) missense probably damaging 1.00
R6838:Dock9 UTSW 14 121,784,008 (GRCm39) missense possibly damaging 0.71
R6868:Dock9 UTSW 14 121,823,676 (GRCm39) missense probably benign 0.37
R6919:Dock9 UTSW 14 121,880,564 (GRCm39) missense probably benign 0.42
R6989:Dock9 UTSW 14 121,864,791 (GRCm39) missense probably damaging 1.00
R7539:Dock9 UTSW 14 121,818,848 (GRCm39) missense probably damaging 1.00
R7645:Dock9 UTSW 14 121,835,075 (GRCm39) missense probably benign 0.44
R7875:Dock9 UTSW 14 121,863,396 (GRCm39) nonsense probably null
R7900:Dock9 UTSW 14 121,783,491 (GRCm39) missense possibly damaging 0.84
R8040:Dock9 UTSW 14 121,889,206 (GRCm39) missense probably benign 0.06
R8420:Dock9 UTSW 14 121,783,454 (GRCm39) missense probably damaging 1.00
R8511:Dock9 UTSW 14 121,918,847 (GRCm39) missense probably damaging 1.00
R8511:Dock9 UTSW 14 121,864,801 (GRCm39) missense probably benign 0.40
R8514:Dock9 UTSW 14 121,896,199 (GRCm39) missense probably benign 0.25
R8691:Dock9 UTSW 14 121,877,517 (GRCm39) missense possibly damaging 0.49
R8804:Dock9 UTSW 14 121,842,595 (GRCm39) missense probably damaging 0.98
R8894:Dock9 UTSW 14 121,860,373 (GRCm39) missense probably benign 0.10
R8900:Dock9 UTSW 14 121,817,940 (GRCm39) missense probably damaging 1.00
R9069:Dock9 UTSW 14 121,866,324 (GRCm39) missense probably damaging 0.98
R9218:Dock9 UTSW 14 121,905,871 (GRCm39) missense probably damaging 1.00
R9233:Dock9 UTSW 14 121,820,781 (GRCm39) missense probably benign 0.09
R9236:Dock9 UTSW 14 121,876,970 (GRCm39) missense probably damaging 1.00
R9285:Dock9 UTSW 14 121,833,012 (GRCm39) missense probably benign
R9451:Dock9 UTSW 14 121,787,601 (GRCm39) splice site probably benign
R9461:Dock9 UTSW 14 121,842,601 (GRCm39) missense probably benign 0.05
R9484:Dock9 UTSW 14 121,818,844 (GRCm39) missense probably damaging 1.00
R9517:Dock9 UTSW 14 121,829,236 (GRCm39) missense probably benign 0.07
R9542:Dock9 UTSW 14 121,864,775 (GRCm39) missense probably damaging 1.00
R9694:Dock9 UTSW 14 121,818,791 (GRCm39) missense probably damaging 1.00
R9701:Dock9 UTSW 14 121,876,983 (GRCm39) missense probably benign 0.01
R9703:Dock9 UTSW 14 121,781,989 (GRCm39) makesense probably null
R9726:Dock9 UTSW 14 121,835,149 (GRCm39) missense possibly damaging 0.61
R9741:Dock9 UTSW 14 121,877,516 (GRCm39) missense probably damaging 1.00
Z1088:Dock9 UTSW 14 121,792,687 (GRCm39) missense probably damaging 1.00
Z1176:Dock9 UTSW 14 121,889,194 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CAGACTGAAGTGTCTGTCACTCGTG -3'
(R):5'- GATGGAGTGTGGCTGACATCAGTTC -3'

Sequencing Primer
(F):5'- CTGTCACTCGTGTAAAATAATTCCC -3'
(R):5'- AGCGGATTTTAGCTGTACAAGG -3'
Posted On 2014-04-24