Incidental Mutation 'R1637:Lrrk2'
Institutional Source Beutler Lab
Gene Symbol Lrrk2
Ensembl Gene ENSMUSG00000036273
Gene Nameleucine-rich repeat kinase 2
Synonyms9330188B09Rik, 4921513O20Rik, LOC381026, cI-46, D630001M17Rik
MMRRC Submission 039673-MU
Accession Numbers

Genbank: NM_025730; MGI: 1913975

Is this an essential gene? Possibly essential (E-score: 0.516) question?
Stock #R1637 (G1)
Quality Score225
Status Not validated
Chromosomal Location91673175-91816120 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 91734058 bp
Amino Acid Change Leucine to Arginine at position 920 (L920R)
Ref Sequence ENSEMBL: ENSMUSP00000052584 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060642]
AlphaFold Q5S006
Predicted Effect probably benign
Transcript: ENSMUST00000060642
AA Change: L920R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000052584
Gene: ENSMUSG00000036273
AA Change: L920R

low complexity region 138 156 N/A INTRINSIC
low complexity region 332 347 N/A INTRINSIC
ANK 708 737 3.95e1 SMART
ANK 770 800 4.58e2 SMART
low complexity region 890 901 N/A INTRINSIC
low complexity region 953 966 N/A INTRINSIC
low complexity region 971 979 N/A INTRINSIC
LRR 1010 1033 9.96e-1 SMART
LRR 1034 1057 8.01e0 SMART
LRR 1082 1105 2.45e0 SMART
LRR 1128 1151 9.3e-1 SMART
LRR 1195 1219 3.24e0 SMART
LRR 1244 1266 3.87e1 SMART
LRR 1267 1291 4.98e1 SMART
Pfam:Roc 1336 1456 4.9e-32 PFAM
Pfam:Ras 1336 1489 3.3e-17 PFAM
Pfam:COR 1524 1740 4e-28 PFAM
Pfam:Pkinase 1881 2132 4.7e-40 PFAM
Pfam:Pkinase_Tyr 1882 2132 6.8e-39 PFAM
WD40 2231 2276 3.09e-1 SMART
WD40 2401 2438 1.37e2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140734
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the leucine-rich repeat kinase family and encodes a protein with an ankryin repeat region, a leucine-rich repeat (LRR) domain, a kinase domain, a DFG-like motif, a RAS domain, a GTPase domain, a MLK-like domain, and a WD40 domain. The protein is present largely in the cytoplasm but also associates with the mitochondrial outer membrane. Mutations in this gene have been associated with Parkinson disease-8. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit impaired response to dopamine, amphetamine, and quinpirole. Mice homozygous for one knock-out allele exhibit increased neurite growth. Mice homozygous for different knock-out alleles exhibit alopecia due to excessive grooming or kdiney atrophy. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, knock-out(6) Targeted, other(1)

Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik T A 5: 109,738,992 H50L probably benign Het
A2m C A 6: 121,654,612 L623M probably benign Het
Agpat5 A G 8: 18,881,811 R316G probably benign Het
Ankrd39 G A 1: 36,539,492 Q151* probably null Het
Arl13b T C 16: 62,830,784 D30G probably damaging Het
Atpaf1 A G 4: 115,788,302 S123G probably benign Het
Bicra A G 7: 15,972,689 S1276P probably benign Het
Car1 T C 3: 14,777,786 I60V possibly damaging Het
Cnbd2 A G 2: 156,373,724 I411V probably damaging Het
Cyp2c37 A T 19: 40,001,982 K375* probably null Het
Cysrt1 T C 2: 25,239,285 I72V probably benign Het
Dock9 T A 14: 121,651,775 D312V possibly damaging Het
Ecd T C 14: 20,346,692 I42V probably damaging Het
Ercc5 A G 1: 44,167,534 T536A probably benign Het
Gjd2 A T 2: 114,011,308 Y229* probably null Het
Gramd1b A T 9: 40,304,538 probably null Het
Hcrtr2 T C 9: 76,232,999 T336A probably benign Het
Hjurp G A 1: 88,266,121 S279F probably benign Het
Ift140 C T 17: 25,025,634 L152F probably benign Het
Izumo1r A G 9: 14,901,809 C56R probably damaging Het
Kif7 T C 7: 79,702,837 E850G probably damaging Het
Larp4b C G 13: 9,151,097 T335S probably benign Het
Lmo7 A T 14: 101,880,832 R42S probably damaging Het
Mapk8 G A 14: 33,410,962 R6C probably benign Het
Mpped1 C T 15: 83,791,990 probably benign Het
Myoc A G 1: 162,639,367 Y35C probably damaging Het
Ndufb8 C T 19: 44,555,035 M66I probably benign Het
Nkpd1 T C 7: 19,523,979 I411T probably benign Het
Nrxn3 A G 12: 89,354,468 N382S possibly damaging Het
Olfr1219 A T 2: 89,075,052 L13Q probably damaging Het
Olfr328 A T 11: 58,551,420 V273E possibly damaging Het
Pear1 T C 3: 87,756,753 E303G probably damaging Het
Plekhg4 T A 8: 105,381,781 M1047K probably benign Het
Pofut1 T G 2: 153,265,789 F268C probably damaging Het
Psrc1 G T 3: 108,385,293 S134I probably damaging Het
Slc6a2 A T 8: 92,981,990 I245F probably benign Het
Slc9a1 T C 4: 133,422,223 S787P probably benign Het
Sorcs3 T A 19: 48,748,359 probably null Het
Syne2 C A 12: 75,996,002 H3916N probably damaging Het
Taar6 A G 10: 23,985,181 S156P probably benign Het
Tnn A G 1: 160,147,600 F86L probably damaging Het
Tspear T A 10: 77,870,419 L341H possibly damaging Het
Ttll8 A G 15: 88,914,444 V696A probably benign Het
Utrn C A 10: 12,436,364 D616Y probably damaging Het
Vmn2r18 A T 5: 151,584,757 C301S probably damaging Het
Xdh T C 17: 73,900,578 Y928C probably benign Het
Zfand1 G A 3: 10,345,982 A104V probably benign Het
Other mutations in Lrrk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Lrrk2 APN 15 91747799 missense possibly damaging 0.90
IGL00542:Lrrk2 APN 15 91699943 missense probably benign
IGL00770:Lrrk2 APN 15 91801833 splice site probably benign
IGL00774:Lrrk2 APN 15 91801833 splice site probably benign
IGL00791:Lrrk2 APN 15 91779841 missense probably damaging 1.00
IGL00827:Lrrk2 APN 15 91755790 missense probably damaging 1.00
IGL00843:Lrrk2 APN 15 91757058 missense possibly damaging 0.58
IGL01109:Lrrk2 APN 15 91738832 missense probably damaging 1.00
IGL01293:Lrrk2 APN 15 91726137 missense probably benign 0.21
IGL01296:Lrrk2 APN 15 91683142 missense probably benign
IGL01301:Lrrk2 APN 15 91767339 missense probably damaging 1.00
IGL01360:Lrrk2 APN 15 91700569 splice site probably null
IGL01465:Lrrk2 APN 15 91728925 missense probably benign 0.21
IGL01529:Lrrk2 APN 15 91812313 missense possibly damaging 0.92
IGL01557:Lrrk2 APN 15 91699989 missense probably damaging 1.00
IGL01560:Lrrk2 APN 15 91774988 missense probably benign 0.33
IGL01991:Lrrk2 APN 15 91779946 missense probably damaging 0.99
IGL02003:Lrrk2 APN 15 91731491 missense probably damaging 0.99
IGL02325:Lrrk2 APN 15 91726308 critical splice donor site probably null
IGL02711:Lrrk2 APN 15 91685822 missense possibly damaging 0.71
IGL02869:Lrrk2 APN 15 91750277 missense probably damaging 1.00
IGL03104:Lrrk2 APN 15 91747755 missense possibly damaging 0.68
IGL03179:Lrrk2 APN 15 91700578 missense probably damaging 1.00
IGL03395:Lrrk2 APN 15 91797414 splice site probably null
horned UTSW 15 91772858 missense probably damaging 1.00
R1312_Lrrk2_980 UTSW 15 91699895 missense probably damaging 1.00
R4710_lrrk2_232 UTSW 15 91699927 missense possibly damaging 0.88
R5245_Lrrk2_127 UTSW 15 91796089 missense probably damaging 1.00
spree UTSW 15 91702247 missense probably benign 0.00
Spur UTSW 15 91774995 nonsense probably null
3-1:Lrrk2 UTSW 15 91801934 missense probably benign 0.01
ANU18:Lrrk2 UTSW 15 91767339 missense probably damaging 1.00
H8562:Lrrk2 UTSW 15 91673358 missense probably benign
H8786:Lrrk2 UTSW 15 91673358 missense probably benign
IGL02835:Lrrk2 UTSW 15 91814660 critical splice acceptor site probably null
R0014:Lrrk2 UTSW 15 91802045 splice site probably benign
R0014:Lrrk2 UTSW 15 91802045 splice site probably benign
R0078:Lrrk2 UTSW 15 91734009 missense probably benign 0.01
R0100:Lrrk2 UTSW 15 91745796 missense probably damaging 1.00
R0282:Lrrk2 UTSW 15 91778414 splice site probably benign
R0448:Lrrk2 UTSW 15 91709305 missense probably damaging 0.99
R0449:Lrrk2 UTSW 15 91750275 missense probably damaging 1.00
R0610:Lrrk2 UTSW 15 91815416 missense probably benign
R0617:Lrrk2 UTSW 15 91752278 missense probably benign 0.00
R0632:Lrrk2 UTSW 15 91796028 missense probably damaging 0.98
R0639:Lrrk2 UTSW 15 91772996 missense probably benign 0.03
R0661:Lrrk2 UTSW 15 91787016 missense probably damaging 1.00
R0666:Lrrk2 UTSW 15 91757070 critical splice donor site probably null
R0764:Lrrk2 UTSW 15 91775046 splice site probably null
R0766:Lrrk2 UTSW 15 91699895 missense probably damaging 1.00
R0845:Lrrk2 UTSW 15 91755962 missense probably benign 0.22
R0940:Lrrk2 UTSW 15 91729081 missense possibly damaging 0.83
R0970:Lrrk2 UTSW 15 91729169 missense probably benign 0.22
R1080:Lrrk2 UTSW 15 91673689 missense probably benign 0.01
R1114:Lrrk2 UTSW 15 91700468 nonsense probably null
R1223:Lrrk2 UTSW 15 91673635 missense probably benign 0.00
R1289:Lrrk2 UTSW 15 91812360 missense probably benign 0.00
R1296:Lrrk2 UTSW 15 91728920 missense probably damaging 1.00
R1312:Lrrk2 UTSW 15 91699895 missense probably damaging 1.00
R1773:Lrrk2 UTSW 15 91779981 missense possibly damaging 0.96
R1809:Lrrk2 UTSW 15 91699892 missense possibly damaging 0.86
R1839:Lrrk2 UTSW 15 91683134 missense probably benign 0.00
R1946:Lrrk2 UTSW 15 91736661 splice site probably null
R2160:Lrrk2 UTSW 15 91796060 missense probably damaging 1.00
R2232:Lrrk2 UTSW 15 91764716 missense probably benign 0.05
R2419:Lrrk2 UTSW 15 91797526 splice site probably benign
R2516:Lrrk2 UTSW 15 91755927 missense probably benign
R3110:Lrrk2 UTSW 15 91814695 missense probably benign 0.02
R3112:Lrrk2 UTSW 15 91814695 missense probably benign 0.02
R3801:Lrrk2 UTSW 15 91737111 missense probably benign
R3842:Lrrk2 UTSW 15 91755916 missense probably benign 0.01
R3903:Lrrk2 UTSW 15 91747700 missense probably damaging 1.00
R3903:Lrrk2 UTSW 15 91747701 missense probably damaging 1.00
R3930:Lrrk2 UTSW 15 91767461 critical splice donor site probably null
R3937:Lrrk2 UTSW 15 91778504 missense probably damaging 0.98
R3938:Lrrk2 UTSW 15 91712780 missense possibly damaging 0.69
R3938:Lrrk2 UTSW 15 91778504 missense probably damaging 0.98
R3982:Lrrk2 UTSW 15 91709284 missense probably benign 0.22
R4125:Lrrk2 UTSW 15 91815483 missense probably benign 0.01
R4130:Lrrk2 UTSW 15 91755794 missense probably benign 0.19
R4296:Lrrk2 UTSW 15 91699895 missense probably damaging 1.00
R4465:Lrrk2 UTSW 15 91747820 missense probably damaging 0.96
R4478:Lrrk2 UTSW 15 91723188 missense probably damaging 1.00
R4517:Lrrk2 UTSW 15 91705120 missense probably benign
R4539:Lrrk2 UTSW 15 91729142 missense possibly damaging 0.86
R4654:Lrrk2 UTSW 15 91765681 missense probably damaging 0.96
R4710:Lrrk2 UTSW 15 91699927 missense possibly damaging 0.88
R4722:Lrrk2 UTSW 15 91688901 missense probably damaging 1.00
R4723:Lrrk2 UTSW 15 91764759 missense probably damaging 1.00
R4732:Lrrk2 UTSW 15 91688849 missense probably damaging 1.00
R4732:Lrrk2 UTSW 15 91765747 missense probably damaging 1.00
R4733:Lrrk2 UTSW 15 91688849 missense probably damaging 1.00
R4733:Lrrk2 UTSW 15 91765747 missense probably damaging 1.00
R4787:Lrrk2 UTSW 15 91712828 missense probably benign
R4945:Lrrk2 UTSW 15 91804920 missense probably benign 0.02
R4948:Lrrk2 UTSW 15 91803389 missense probably benign 0.20
R5000:Lrrk2 UTSW 15 91749878 missense probably damaging 1.00
R5031:Lrrk2 UTSW 15 91700619 missense possibly damaging 0.50
R5067:Lrrk2 UTSW 15 91765790 missense probably benign 0.01
R5245:Lrrk2 UTSW 15 91796089 missense probably damaging 1.00
R5341:Lrrk2 UTSW 15 91772858 missense probably damaging 1.00
R5460:Lrrk2 UTSW 15 91814644 splice site probably null
R5551:Lrrk2 UTSW 15 91812350 missense probably benign
R5574:Lrrk2 UTSW 15 91787016 missense probably damaging 1.00
R5577:Lrrk2 UTSW 15 91765745 missense probably damaging 1.00
R5685:Lrrk2 UTSW 15 91803301 nonsense probably null
R5712:Lrrk2 UTSW 15 91702222 nonsense probably null
R5728:Lrrk2 UTSW 15 91774974 missense probably benign 0.36
R5782:Lrrk2 UTSW 15 91702183 missense probably damaging 1.00
R5788:Lrrk2 UTSW 15 91764648 missense possibly damaging 0.55
R5821:Lrrk2 UTSW 15 91709390 critical splice donor site probably null
R5852:Lrrk2 UTSW 15 91755949 missense probably damaging 1.00
R5934:Lrrk2 UTSW 15 91734046 missense probably benign 0.00
R5935:Lrrk2 UTSW 15 91745831 missense probably benign 0.14
R5979:Lrrk2 UTSW 15 91772945 missense possibly damaging 0.47
R6101:Lrrk2 UTSW 15 91723135 missense probably benign 0.10
R6114:Lrrk2 UTSW 15 91747826 missense probably benign 0.33
R6259:Lrrk2 UTSW 15 91702247 missense probably benign 0.00
R6376:Lrrk2 UTSW 15 91742266 missense possibly damaging 0.89
R6417:Lrrk2 UTSW 15 91812346 missense probably benign 0.03
R6420:Lrrk2 UTSW 15 91812346 missense probably benign 0.03
R6737:Lrrk2 UTSW 15 91723218 missense possibly damaging 0.50
R7056:Lrrk2 UTSW 15 91774995 nonsense probably null
R7072:Lrrk2 UTSW 15 91801920 missense probably benign 0.03
R7109:Lrrk2 UTSW 15 91764782 missense probably damaging 1.00
R7128:Lrrk2 UTSW 15 91801885 missense probably benign
R7144:Lrrk2 UTSW 15 91734055 missense possibly damaging 0.54
R7187:Lrrk2 UTSW 15 91757001 missense possibly damaging 0.92
R7270:Lrrk2 UTSW 15 91700441 missense probably benign 0.01
R7356:Lrrk2 UTSW 15 91738744 missense probably benign 0.07
R7360:Lrrk2 UTSW 15 91731655 critical splice donor site probably null
R7373:Lrrk2 UTSW 15 91700004 critical splice donor site probably null
R7465:Lrrk2 UTSW 15 91767340 missense probably damaging 1.00
R7477:Lrrk2 UTSW 15 91812325 missense probably damaging 0.98
R7614:Lrrk2 UTSW 15 91772858 missense probably damaging 1.00
R7622:Lrrk2 UTSW 15 91812323 missense probably damaging 1.00
R7658:Lrrk2 UTSW 15 91700358 missense possibly damaging 0.91
R7679:Lrrk2 UTSW 15 91726186 missense possibly damaging 0.58
R7737:Lrrk2 UTSW 15 91815446 missense probably damaging 0.98
R7739:Lrrk2 UTSW 15 91700613 missense probably damaging 1.00
R7740:Lrrk2 UTSW 15 91767324 missense probably damaging 1.00
R7908:Lrrk2 UTSW 15 91726152 missense probably damaging 1.00
R8299:Lrrk2 UTSW 15 91673240 start gained probably benign
R8389:Lrrk2 UTSW 15 91699991 missense probably damaging 1.00
R8462:Lrrk2 UTSW 15 91731477 missense probably benign
R8698:Lrrk2 UTSW 15 91752197 missense probably benign 0.38
R8947:Lrrk2 UTSW 15 91702270 nonsense probably null
R9084:Lrrk2 UTSW 15 91750266 missense
R9086:Lrrk2 UTSW 15 91755848 missense probably benign 0.01
R9096:Lrrk2 UTSW 15 91673256 start gained probably benign
R9097:Lrrk2 UTSW 15 91673256 start gained probably benign
RF001:Lrrk2 UTSW 15 91736633 missense probably benign 0.11
X0028:Lrrk2 UTSW 15 91738851 missense probably benign 0.00
Z1088:Lrrk2 UTSW 15 91726240 missense probably benign 0.12
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- tgtgtgtgagtgtgtgtgag -3'
Posted On2014-04-24