Mutagenetix > Incidental Mutation

Incidental Mutation 'R1637:Ift140'

173273

Institutional Source

Beutler Lab

Gene Symbol

Ift140

Ensembl Gene

ENSMUSG00000024169

Gene Name

intraflagellar transport 140

Synonyms

Tce5, Wdtc2

MMRRC Submission

039673-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1637 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

25016091-25099495 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 25025634 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Phenylalanine at position 152 (L152F)

Ref Sequence

ENSEMBL: ENSMUSP00000116163 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024983] [ENSMUST00000137386] [ENSMUST00000156945]

AlphaFold

E9PY46

Predicted Effect

probably benign
Transcript: ENSMUST00000024983
AA Change: L152F

PolyPhen 2 Score 0.397 (Sensitivity: 0.89; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000024983
Gene: ENSMUSG00000024169
AA Change: L152F

Domain	Start	End	E-Value	Type
WD40	55	89	6.14e1	SMART
WD40	91	131	1.49e0	SMART
Blast:WD40	252	304	3e-15	BLAST
WD40	308	352	2.76e0	SMART
Blast:WD40	364	405	8e-17	BLAST
Blast:WD40	510	547	6e-13	BLAST
Blast:WD40	560	603	3e-7	BLAST
Blast:TPR	863	896	9e-13	BLAST
Blast:TPR	1011	1044	1e-13	BLAST
Blast:TPR	1377	1410	8e-13	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000137386
AA Change: L152F

PolyPhen 2 Score 0.397 (Sensitivity: 0.89; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000116163
Gene: ENSMUSG00000024169
AA Change: L152F

Domain	Start	End	E-Value	Type
WD40	55	89	6.14e1	SMART
WD40	91	131	1.49e0	SMART
Blast:WD40	252	304	3e-15	BLAST
WD40	308	352	2.76e0	SMART
Blast:WD40	364	405	1e-16	BLAST
Blast:WD40	510	547	5e-13	BLAST
Blast:WD40	560	603	3e-7	BLAST
Blast:TPR	863	896	8e-13	BLAST
Blast:TPR	1011	1044	9e-14	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142000

Predicted Effect

probably benign
Transcript: ENSMUST00000156945

SMART Domains

Protein: ENSMUSP00000116689
Gene: ENSMUSG00000024169

Domain	Start	End	E-Value	Type
Blast:WD40	2	35	6e-12	BLAST
SCOP:d1erja_	19	131	5e-7	SMART
Blast:WD40	39	83	1e-24	BLAST
Blast:WD40	95	136	2e-18	BLAST

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.4%
20x: 92.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the subunits of the intraflagellar transport (IFT) complex A. Intraflagellar transport is involved in the genesis, resorption and signaling of primary cilia. The primary cilium is a microtubule-based sensory organelle at the surface of most quiescent mammalian cells, that receives signals from its environment, such as the flow of fluid, light or odors, and transduces those signals to the nucleus. Loss of the corresponding protein in mouse results in renal cystic disease. [provided by RefSeq, Jun 2012]
PHENOTYPE: Mice homozygous for a reporter knock-out allele die at mid-gestation. Mice homozygous for an ENU-induced mutation exhibit cardiovascular defects and situs abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930522L14Rik	T	A	5: 109,738,992	H50L	probably benign	Het
A2m	C	A	6: 121,654,612	L623M	probably benign	Het
Agpat5	A	G	8: 18,881,811	R316G	probably benign	Het
Ankrd39	G	A	1: 36,539,492	Q151*	probably null	Het
Arl13b	T	C	16: 62,830,784	D30G	probably damaging	Het
Atpaf1	A	G	4: 115,788,302	S123G	probably benign	Het
Bicra	A	G	7: 15,972,689	S1276P	probably benign	Het
Car1	T	C	3: 14,777,786	I60V	possibly damaging	Het
Cnbd2	A	G	2: 156,373,724	I411V	probably damaging	Het
Cyp2c37	A	T	19: 40,001,982	K375*	probably null	Het
Cysrt1	T	C	2: 25,239,285	I72V	probably benign	Het
Dock9	T	A	14: 121,651,775	D312V	possibly damaging	Het
Ecd	T	C	14: 20,346,692	I42V	probably damaging	Het
Ercc5	A	G	1: 44,167,534	T536A	probably benign	Het
Gjd2	A	T	2: 114,011,308	Y229*	probably null	Het
Gramd1b	A	T	9: 40,304,538		probably null	Het
Hcrtr2	T	C	9: 76,232,999	T336A	probably benign	Het
Hjurp	G	A	1: 88,266,121	S279F	probably benign	Het
Izumo1r	A	G	9: 14,901,809	C56R	probably damaging	Het
Kif7	T	C	7: 79,702,837	E850G	probably damaging	Het
Larp4b	C	G	13: 9,151,097	T335S	probably benign	Het
Lmo7	A	T	14: 101,880,832	R42S	probably damaging	Het
Lrrk2	T	G	15: 91,734,058	L920R	probably benign	Het
Mapk8	G	A	14: 33,410,962	R6C	probably benign	Het
Mpped1	C	T	15: 83,791,990		probably benign	Het
Myoc	A	G	1: 162,639,367	Y35C	probably damaging	Het
Ndufb8	C	T	19: 44,555,035	M66I	probably benign	Het
Nkpd1	T	C	7: 19,523,979	I411T	probably benign	Het
Nrxn3	A	G	12: 89,354,468	N382S	possibly damaging	Het
Olfr1219	A	T	2: 89,075,052	L13Q	probably damaging	Het
Olfr328	A	T	11: 58,551,420	V273E	possibly damaging	Het
Pear1	T	C	3: 87,756,753	E303G	probably damaging	Het
Plekhg4	T	A	8: 105,381,781	M1047K	probably benign	Het
Pofut1	T	G	2: 153,265,789	F268C	probably damaging	Het
Psrc1	G	T	3: 108,385,293	S134I	probably damaging	Het
Slc6a2	A	T	8: 92,981,990	I245F	probably benign	Het
Slc9a1	T	C	4: 133,422,223	S787P	probably benign	Het
Sorcs3	T	A	19: 48,748,359		probably null	Het
Syne2	C	A	12: 75,996,002	H3916N	probably damaging	Het
Taar6	A	G	10: 23,985,181	S156P	probably benign	Het
Tnn	A	G	1: 160,147,600	F86L	probably damaging	Het
Tspear	T	A	10: 77,870,419	L341H	possibly damaging	Het
Ttll8	A	G	15: 88,914,444	V696A	probably benign	Het
Utrn	C	A	10: 12,436,364	D616Y	probably damaging	Het
Vmn2r18	A	T	5: 151,584,757	C301S	probably damaging	Het
Xdh	T	C	17: 73,900,578	Y928C	probably benign	Het
Zfand1	G	A	3: 10,345,982	A104V	probably benign	Het

Other mutations in Ift140

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00753:Ift140	APN	17	25055644	missense	probably damaging	1.00
IGL00966:Ift140	APN	17	25018802	missense	probably damaging	1.00
IGL01082:Ift140	APN	17	25048455	missense	possibly damaging	0.89
IGL01394:Ift140	APN	17	25094702	missense	probably benign	0.02
IGL01816:Ift140	APN	17	25087025	splice site	probably null
IGL01994:Ift140	APN	17	25048443	missense	probably damaging	1.00
IGL02102:Ift140	APN	17	25033130	missense	probably benign	0.03
IGL02207:Ift140	APN	17	25055598	missense	probably benign
IGL02493:Ift140	APN	17	25087924	nonsense	probably null
IGL02735:Ift140	APN	17	25034035	splice site	probably benign
IGL02902:Ift140	APN	17	25090762	missense	probably damaging	1.00
IGL03037:Ift140	APN	17	25092394	missense	probably benign	0.02
IGL03122:Ift140	APN	17	25086910	missense	probably damaging	1.00
IGL03206:Ift140	APN	17	25092826	missense	probably damaging	0.98
IGL03271:Ift140	APN	17	25087906	missense	probably damaging	1.00
IGL03358:Ift140	APN	17	25087984	missense	probably damaging	1.00
PIT4515001:Ift140	UTSW	17	25086860	missense	probably damaging	0.98
R0100:Ift140	UTSW	17	25090954	nonsense	probably null
R0100:Ift140	UTSW	17	25090954	nonsense	probably null
R0197:Ift140	UTSW	17	25090933	missense	probably benign	0.09
R0238:Ift140	UTSW	17	25045523	nonsense	probably null
R0238:Ift140	UTSW	17	25045523	nonsense	probably null
R0239:Ift140	UTSW	17	25045523	nonsense	probably null
R0239:Ift140	UTSW	17	25045523	nonsense	probably null
R0355:Ift140	UTSW	17	25048435	nonsense	probably null
R0399:Ift140	UTSW	17	25050340	missense	possibly damaging	0.77
R0574:Ift140	UTSW	17	25051760	splice site	probably null
R0610:Ift140	UTSW	17	25035803	missense	probably benign	0.06
R0701:Ift140	UTSW	17	25090933	missense	probably benign	0.09
R0883:Ift140	UTSW	17	25090933	missense	probably benign	0.09
R0900:Ift140	UTSW	17	25035812	missense	probably benign	0.22
R1167:Ift140	UTSW	17	25035745	missense	probably benign	0.01
R1295:Ift140	UTSW	17	25088933	critical splice donor site	probably null
R1588:Ift140	UTSW	17	25087985	missense	probably damaging	1.00
R1619:Ift140	UTSW	17	25088865	missense	probably damaging	1.00
R1854:Ift140	UTSW	17	25035839	missense	probably benign	0.05
R2397:Ift140	UTSW	17	25020736	missense	probably damaging	1.00
R2510:Ift140	UTSW	17	25036308	missense	probably benign	0.02
R2918:Ift140	UTSW	17	25035831	missense	possibly damaging	0.66
R3433:Ift140	UTSW	17	25036308	missense	probably benign	0.02
R3878:Ift140	UTSW	17	25028944	missense	probably benign	0.25
R4559:Ift140	UTSW	17	25090767	missense	probably damaging	0.97
R4670:Ift140	UTSW	17	25098961	unclassified	probably benign
R4711:Ift140	UTSW	17	25094717	splice site	probably null
R4934:Ift140	UTSW	17	25048488	missense	probably benign
R4949:Ift140	UTSW	17	25094665	missense	probably benign	0.06
R4982:Ift140	UTSW	17	25036994	missense	probably damaging	0.99
R5099:Ift140	UTSW	17	25090700	missense	probably damaging	1.00
R5223:Ift140	UTSW	17	25035812	missense	probably benign	0.22
R5268:Ift140	UTSW	17	25020627	missense	possibly damaging	0.48
R5423:Ift140	UTSW	17	25033085	missense	probably damaging	0.96
R5480:Ift140	UTSW	17	25020576	missense	probably damaging	1.00
R5655:Ift140	UTSW	17	25045064	missense	probably damaging	1.00
R5756:Ift140	UTSW	17	25028813	missense	possibly damaging	0.62
R5837:Ift140	UTSW	17	25089540	missense	probably damaging	1.00
R5894:Ift140	UTSW	17	25033919	missense	possibly damaging	0.92
R5907:Ift140	UTSW	17	25092371	missense	probably benign	0.02
R5966:Ift140	UTSW	17	25094761	nonsense	probably null
R6000:Ift140	UTSW	17	25036960	missense	probably benign	0.00
R6046:Ift140	UTSW	17	25055589	missense	probably benign	0.00
R6050:Ift140	UTSW	17	25091005	missense	probably damaging	1.00
R6103:Ift140	UTSW	17	25093126	missense	probably damaging	1.00
R6239:Ift140	UTSW	17	25028972	missense	probably benign	0.26
R6287:Ift140	UTSW	17	25050434	missense	probably benign
R6539:Ift140	UTSW	17	25094669	missense	possibly damaging	0.87
R6656:Ift140	UTSW	17	25032173	missense	probably damaging	0.96
R6723:Ift140	UTSW	17	25033116	missense	probably benign	0.08
R6749:Ift140	UTSW	17	25098916	missense	probably damaging	0.99
R6892:Ift140	UTSW	17	25020546	missense	possibly damaging	0.95
R7151:Ift140	UTSW	17	25055725	missense	probably damaging	1.00
R7235:Ift140	UTSW	17	25020645	missense	possibly damaging	0.88
R7424:Ift140	UTSW	17	25037036	missense	possibly damaging	0.81
R7552:Ift140	UTSW	17	25033115	missense	probably benign	0.02
R7560:Ift140	UTSW	17	25092341	missense	probably benign	0.28
R7660:Ift140	UTSW	17	25051824	missense	probably damaging	1.00
R8105:Ift140	UTSW	17	25036975	missense	probably benign	0.01
R8415:Ift140	UTSW	17	25092915	missense	probably damaging	0.99
R8437:Ift140	UTSW	17	25094677	missense	probably damaging	0.99
R8747:Ift140	UTSW	17	25035835	missense	probably benign
R8932:Ift140	UTSW	17	25086888	missense	probably benign	0.03
R9226:Ift140	UTSW	17	25098865	missense	probably benign	0.00
R9347:Ift140	UTSW	17	25094779	missense	probably benign	0.00
R9451:Ift140	UTSW	17	25033951	missense	probably benign	0.33
R9456:Ift140	UTSW	17	25035784	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- GGGAAGTGTTCCTCACACATGTTCTG -3'
(R):5'- AAGTTGCTCACCATCCATGAGACTG -3'

Sequencing Primer
(F):5'- CTGTAGGGTGTGTTCCTCAC -3'
(R):5'- TCTCCAGTTAAACATGTCCAGGG -3'

Posted On

2014-04-24