Incidental Mutation 'R1637:Ift140'
ID 173273
Institutional Source Beutler Lab
Gene Symbol Ift140
Ensembl Gene ENSMUSG00000024169
Gene Name intraflagellar transport 140
Synonyms Tce5, Wdtc2
MMRRC Submission 039673-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1637 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 25016091-25099495 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 25025634 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Phenylalanine at position 152 (L152F)
Ref Sequence ENSEMBL: ENSMUSP00000116163 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024983] [ENSMUST00000137386] [ENSMUST00000156945]
AlphaFold E9PY46
Predicted Effect probably benign
Transcript: ENSMUST00000024983
AA Change: L152F

PolyPhen 2 Score 0.397 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000024983
Gene: ENSMUSG00000024169
AA Change: L152F

DomainStartEndE-ValueType
WD40 55 89 6.14e1 SMART
WD40 91 131 1.49e0 SMART
Blast:WD40 252 304 3e-15 BLAST
WD40 308 352 2.76e0 SMART
Blast:WD40 364 405 8e-17 BLAST
Blast:WD40 510 547 6e-13 BLAST
Blast:WD40 560 603 3e-7 BLAST
Blast:TPR 863 896 9e-13 BLAST
Blast:TPR 1011 1044 1e-13 BLAST
Blast:TPR 1377 1410 8e-13 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000137386
AA Change: L152F

PolyPhen 2 Score 0.397 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000116163
Gene: ENSMUSG00000024169
AA Change: L152F

DomainStartEndE-ValueType
WD40 55 89 6.14e1 SMART
WD40 91 131 1.49e0 SMART
Blast:WD40 252 304 3e-15 BLAST
WD40 308 352 2.76e0 SMART
Blast:WD40 364 405 1e-16 BLAST
Blast:WD40 510 547 5e-13 BLAST
Blast:WD40 560 603 3e-7 BLAST
Blast:TPR 863 896 8e-13 BLAST
Blast:TPR 1011 1044 9e-14 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142000
Predicted Effect probably benign
Transcript: ENSMUST00000156945
SMART Domains Protein: ENSMUSP00000116689
Gene: ENSMUSG00000024169

DomainStartEndE-ValueType
Blast:WD40 2 35 6e-12 BLAST
SCOP:d1erja_ 19 131 5e-7 SMART
Blast:WD40 39 83 1e-24 BLAST
Blast:WD40 95 136 2e-18 BLAST
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the subunits of the intraflagellar transport (IFT) complex A. Intraflagellar transport is involved in the genesis, resorption and signaling of primary cilia. The primary cilium is a microtubule-based sensory organelle at the surface of most quiescent mammalian cells, that receives signals from its environment, such as the flow of fluid, light or odors, and transduces those signals to the nucleus. Loss of the corresponding protein in mouse results in renal cystic disease. [provided by RefSeq, Jun 2012]
PHENOTYPE: Mice homozygous for a reporter knock-out allele die at mid-gestation. Mice homozygous for an ENU-induced mutation exhibit cardiovascular defects and situs abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik T A 5: 109,738,992 H50L probably benign Het
A2m C A 6: 121,654,612 L623M probably benign Het
Agpat5 A G 8: 18,881,811 R316G probably benign Het
Ankrd39 G A 1: 36,539,492 Q151* probably null Het
Arl13b T C 16: 62,830,784 D30G probably damaging Het
Atpaf1 A G 4: 115,788,302 S123G probably benign Het
Bicra A G 7: 15,972,689 S1276P probably benign Het
Car1 T C 3: 14,777,786 I60V possibly damaging Het
Cnbd2 A G 2: 156,373,724 I411V probably damaging Het
Cyp2c37 A T 19: 40,001,982 K375* probably null Het
Cysrt1 T C 2: 25,239,285 I72V probably benign Het
Dock9 T A 14: 121,651,775 D312V possibly damaging Het
Ecd T C 14: 20,346,692 I42V probably damaging Het
Ercc5 A G 1: 44,167,534 T536A probably benign Het
Gjd2 A T 2: 114,011,308 Y229* probably null Het
Gramd1b A T 9: 40,304,538 probably null Het
Hcrtr2 T C 9: 76,232,999 T336A probably benign Het
Hjurp G A 1: 88,266,121 S279F probably benign Het
Izumo1r A G 9: 14,901,809 C56R probably damaging Het
Kif7 T C 7: 79,702,837 E850G probably damaging Het
Larp4b C G 13: 9,151,097 T335S probably benign Het
Lmo7 A T 14: 101,880,832 R42S probably damaging Het
Lrrk2 T G 15: 91,734,058 L920R probably benign Het
Mapk8 G A 14: 33,410,962 R6C probably benign Het
Mpped1 C T 15: 83,791,990 probably benign Het
Myoc A G 1: 162,639,367 Y35C probably damaging Het
Ndufb8 C T 19: 44,555,035 M66I probably benign Het
Nkpd1 T C 7: 19,523,979 I411T probably benign Het
Nrxn3 A G 12: 89,354,468 N382S possibly damaging Het
Olfr1219 A T 2: 89,075,052 L13Q probably damaging Het
Olfr328 A T 11: 58,551,420 V273E possibly damaging Het
Pear1 T C 3: 87,756,753 E303G probably damaging Het
Plekhg4 T A 8: 105,381,781 M1047K probably benign Het
Pofut1 T G 2: 153,265,789 F268C probably damaging Het
Psrc1 G T 3: 108,385,293 S134I probably damaging Het
Slc6a2 A T 8: 92,981,990 I245F probably benign Het
Slc9a1 T C 4: 133,422,223 S787P probably benign Het
Sorcs3 T A 19: 48,748,359 probably null Het
Syne2 C A 12: 75,996,002 H3916N probably damaging Het
Taar6 A G 10: 23,985,181 S156P probably benign Het
Tnn A G 1: 160,147,600 F86L probably damaging Het
Tspear T A 10: 77,870,419 L341H possibly damaging Het
Ttll8 A G 15: 88,914,444 V696A probably benign Het
Utrn C A 10: 12,436,364 D616Y probably damaging Het
Vmn2r18 A T 5: 151,584,757 C301S probably damaging Het
Xdh T C 17: 73,900,578 Y928C probably benign Het
Zfand1 G A 3: 10,345,982 A104V probably benign Het
Other mutations in Ift140
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00753:Ift140 APN 17 25055644 missense probably damaging 1.00
IGL00966:Ift140 APN 17 25018802 missense probably damaging 1.00
IGL01082:Ift140 APN 17 25048455 missense possibly damaging 0.89
IGL01394:Ift140 APN 17 25094702 missense probably benign 0.02
IGL01816:Ift140 APN 17 25087025 splice site probably null
IGL01994:Ift140 APN 17 25048443 missense probably damaging 1.00
IGL02102:Ift140 APN 17 25033130 missense probably benign 0.03
IGL02207:Ift140 APN 17 25055598 missense probably benign
IGL02493:Ift140 APN 17 25087924 nonsense probably null
IGL02735:Ift140 APN 17 25034035 splice site probably benign
IGL02902:Ift140 APN 17 25090762 missense probably damaging 1.00
IGL03037:Ift140 APN 17 25092394 missense probably benign 0.02
IGL03122:Ift140 APN 17 25086910 missense probably damaging 1.00
IGL03206:Ift140 APN 17 25092826 missense probably damaging 0.98
IGL03271:Ift140 APN 17 25087906 missense probably damaging 1.00
IGL03358:Ift140 APN 17 25087984 missense probably damaging 1.00
PIT4515001:Ift140 UTSW 17 25086860 missense probably damaging 0.98
R0100:Ift140 UTSW 17 25090954 nonsense probably null
R0100:Ift140 UTSW 17 25090954 nonsense probably null
R0197:Ift140 UTSW 17 25090933 missense probably benign 0.09
R0238:Ift140 UTSW 17 25045523 nonsense probably null
R0238:Ift140 UTSW 17 25045523 nonsense probably null
R0239:Ift140 UTSW 17 25045523 nonsense probably null
R0239:Ift140 UTSW 17 25045523 nonsense probably null
R0355:Ift140 UTSW 17 25048435 nonsense probably null
R0399:Ift140 UTSW 17 25050340 missense possibly damaging 0.77
R0574:Ift140 UTSW 17 25051760 splice site probably null
R0610:Ift140 UTSW 17 25035803 missense probably benign 0.06
R0701:Ift140 UTSW 17 25090933 missense probably benign 0.09
R0883:Ift140 UTSW 17 25090933 missense probably benign 0.09
R0900:Ift140 UTSW 17 25035812 missense probably benign 0.22
R1167:Ift140 UTSW 17 25035745 missense probably benign 0.01
R1295:Ift140 UTSW 17 25088933 critical splice donor site probably null
R1588:Ift140 UTSW 17 25087985 missense probably damaging 1.00
R1619:Ift140 UTSW 17 25088865 missense probably damaging 1.00
R1854:Ift140 UTSW 17 25035839 missense probably benign 0.05
R2397:Ift140 UTSW 17 25020736 missense probably damaging 1.00
R2510:Ift140 UTSW 17 25036308 missense probably benign 0.02
R2918:Ift140 UTSW 17 25035831 missense possibly damaging 0.66
R3433:Ift140 UTSW 17 25036308 missense probably benign 0.02
R3878:Ift140 UTSW 17 25028944 missense probably benign 0.25
R4559:Ift140 UTSW 17 25090767 missense probably damaging 0.97
R4670:Ift140 UTSW 17 25098961 unclassified probably benign
R4711:Ift140 UTSW 17 25094717 splice site probably null
R4934:Ift140 UTSW 17 25048488 missense probably benign
R4949:Ift140 UTSW 17 25094665 missense probably benign 0.06
R4982:Ift140 UTSW 17 25036994 missense probably damaging 0.99
R5099:Ift140 UTSW 17 25090700 missense probably damaging 1.00
R5223:Ift140 UTSW 17 25035812 missense probably benign 0.22
R5268:Ift140 UTSW 17 25020627 missense possibly damaging 0.48
R5423:Ift140 UTSW 17 25033085 missense probably damaging 0.96
R5480:Ift140 UTSW 17 25020576 missense probably damaging 1.00
R5655:Ift140 UTSW 17 25045064 missense probably damaging 1.00
R5756:Ift140 UTSW 17 25028813 missense possibly damaging 0.62
R5837:Ift140 UTSW 17 25089540 missense probably damaging 1.00
R5894:Ift140 UTSW 17 25033919 missense possibly damaging 0.92
R5907:Ift140 UTSW 17 25092371 missense probably benign 0.02
R5966:Ift140 UTSW 17 25094761 nonsense probably null
R6000:Ift140 UTSW 17 25036960 missense probably benign 0.00
R6046:Ift140 UTSW 17 25055589 missense probably benign 0.00
R6050:Ift140 UTSW 17 25091005 missense probably damaging 1.00
R6103:Ift140 UTSW 17 25093126 missense probably damaging 1.00
R6239:Ift140 UTSW 17 25028972 missense probably benign 0.26
R6287:Ift140 UTSW 17 25050434 missense probably benign
R6539:Ift140 UTSW 17 25094669 missense possibly damaging 0.87
R6656:Ift140 UTSW 17 25032173 missense probably damaging 0.96
R6723:Ift140 UTSW 17 25033116 missense probably benign 0.08
R6749:Ift140 UTSW 17 25098916 missense probably damaging 0.99
R6892:Ift140 UTSW 17 25020546 missense possibly damaging 0.95
R7151:Ift140 UTSW 17 25055725 missense probably damaging 1.00
R7235:Ift140 UTSW 17 25020645 missense possibly damaging 0.88
R7424:Ift140 UTSW 17 25037036 missense possibly damaging 0.81
R7552:Ift140 UTSW 17 25033115 missense probably benign 0.02
R7560:Ift140 UTSW 17 25092341 missense probably benign 0.28
R7660:Ift140 UTSW 17 25051824 missense probably damaging 1.00
R8105:Ift140 UTSW 17 25036975 missense probably benign 0.01
R8415:Ift140 UTSW 17 25092915 missense probably damaging 0.99
R8437:Ift140 UTSW 17 25094677 missense probably damaging 0.99
R8747:Ift140 UTSW 17 25035835 missense probably benign
R8932:Ift140 UTSW 17 25086888 missense probably benign 0.03
R9226:Ift140 UTSW 17 25098865 missense probably benign 0.00
R9347:Ift140 UTSW 17 25094779 missense probably benign 0.00
R9451:Ift140 UTSW 17 25033951 missense probably benign 0.33
R9456:Ift140 UTSW 17 25035784 missense probably benign 0.03
R9782:Ift140 UTSW 17 25045177 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GGGAAGTGTTCCTCACACATGTTCTG -3'
(R):5'- AAGTTGCTCACCATCCATGAGACTG -3'

Sequencing Primer
(F):5'- CTGTAGGGTGTGTTCCTCAC -3'
(R):5'- TCTCCAGTTAAACATGTCCAGGG -3'
Posted On 2014-04-24