Mutagenetix > Incidental Mutation

Incidental Mutation 'R1638:Agfg1'

173279

Institutional Source

Beutler Lab

Gene Symbol

Agfg1

Ensembl Gene

ENSMUSG00000026159

Gene Name

ArfGAP with FG repeats 1

Synonyms

C130049H11Rik, Rip, D730048C23Rik, Hrb

MMRRC Submission

039674-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1638 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

82839483-82901182 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 82893538 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Leucine at position 497 (Q497L)

Ref Sequence

ENSEMBL: ENSMUSP00000140170 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000063380] [ENSMUST00000113444] [ENSMUST00000186302] [ENSMUST00000187899] [ENSMUST00000189220] [ENSMUST00000190052]

AlphaFold

Q8K2K6

Predicted Effect

possibly damaging
Transcript: ENSMUST00000063380
AA Change: Q476L

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000070250
Gene: ENSMUSG00000026159
AA Change: Q476L

Domain	Start	End	E-Value	Type
ArfGap	11	135	9.31e-52	SMART
PDB:2VX8\|D	155	186	3e-6	PDB
low complexity region	214	258	N/A	INTRINSIC
low complexity region	337	353	N/A	INTRINSIC
low complexity region	357	371	N/A	INTRINSIC
internal_repeat_1	415	450	2.43e-6	PROSPERO
low complexity region	452	465	N/A	INTRINSIC
low complexity region	489	510	N/A	INTRINSIC
internal_repeat_1	518	558	2.43e-6	PROSPERO

Predicted Effect

probably damaging
Transcript: ENSMUST00000113444
AA Change: Q466L

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000109071
Gene: ENSMUSG00000026159
AA Change: Q466L

Domain	Start	End	E-Value	Type
ArfGap	11	135	4.7e-54	SMART
PDB:2VX8\|D	155	186	3e-6	PDB
low complexity region	214	258	N/A	INTRINSIC
low complexity region	337	353	N/A	INTRINSIC
low complexity region	357	371	N/A	INTRINSIC
internal_repeat_1	415	450	2.62e-6	PROSPERO
low complexity region	452	465	N/A	INTRINSIC
low complexity region	489	510	N/A	INTRINSIC
internal_repeat_1	520	560	2.62e-6	PROSPERO

Predicted Effect

probably damaging
Transcript: ENSMUST00000186302
AA Change: Q497L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000140785
Gene: ENSMUSG00000026159
AA Change: Q497L

Domain	Start	End	E-Value	Type
ArfGap	11	135	4.6e-54	SMART
PDB:2VX8\|D	155	186	3e-6	PDB
low complexity region	214	258	N/A	INTRINSIC
low complexity region	337	353	N/A	INTRINSIC
low complexity region	357	371	N/A	INTRINSIC
internal_repeat_1	415	450	2.62e-6	PROSPERO
low complexity region	452	465	N/A	INTRINSIC
low complexity region	489	510	N/A	INTRINSIC
internal_repeat_1	520	560	2.62e-6	PROSPERO

Predicted Effect

probably damaging
Transcript: ENSMUST00000187899
AA Change: Q457L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000139503
Gene: ENSMUSG00000026159
AA Change: Q457L

Domain	Start	End	E-Value	Type
ArfGap	11	135	4.6e-54	SMART
PDB:2VX8\|D	155	186	3e-6	PDB
low complexity region	215	231	N/A	INTRINSIC
low complexity region	297	313	N/A	INTRINSIC
low complexity region	317	331	N/A	INTRINSIC
internal_repeat_1	375	410	6.63e-6	PROSPERO
low complexity region	412	425	N/A	INTRINSIC
low complexity region	449	470	N/A	INTRINSIC
internal_repeat_1	480	520	6.63e-6	PROSPERO

Predicted Effect

probably damaging
Transcript: ENSMUST00000189220
AA Change: Q497L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000140170
Gene: ENSMUSG00000026159
AA Change: Q497L

Domain	Start	End	E-Value	Type
ArfGap	11	135	9.31e-52	SMART
PDB:2VX8\|D	155	186	3e-6	PDB
low complexity region	214	258	N/A	INTRINSIC
low complexity region	337	353	N/A	INTRINSIC
low complexity region	357	371	N/A	INTRINSIC
internal_repeat_1	415	450	2.43e-6	PROSPERO
low complexity region	452	465	N/A	INTRINSIC
low complexity region	489	510	N/A	INTRINSIC
internal_repeat_1	518	558	2.43e-6	PROSPERO

Predicted Effect

unknown
Transcript: ENSMUST00000190046
AA Change: Q517L

Predicted Effect

probably damaging
Transcript: ENSMUST00000190052
AA Change: Q473L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000141157
Gene: ENSMUSG00000026159
AA Change: Q473L

Domain	Start	End	E-Value	Type
ArfGap	11	135	4.6e-54	SMART
PDB:2VX8\|D	155	186	3e-6	PDB
low complexity region	215	231	N/A	INTRINSIC
low complexity region	297	313	N/A	INTRINSIC
low complexity region	317	331	N/A	INTRINSIC
internal_repeat_1	375	410	2.33e-5	PROSPERO
low complexity region	465	486	N/A	INTRINSIC
internal_repeat_1	496	536	2.33e-5	PROSPERO

Meta Mutation Damage Score

0.2772

Coding Region Coverage

1x: 99.0%
3x: 97.9%
10x: 94.9%
20x: 87.8%

Validation Efficiency

99% (79/80)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is related to nucleoporins, a class of proteins that mediate nucleocytoplasmic transport. The encoded protein binds the activation domain of the human immunodeficiency virus Rev protein when Rev is assembled onto its RNA target, and is required for the nuclear export of Rev-directed RNAs. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2008]
PHENOTYPE: Male mice homozygous for disruptions in this gene are infertile as a result of abnormalities in spermatogenesis. Otherwise, males and females are normal and live a normal life span. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	C	T	3: 37,035,812	R4130*	probably null	Het
A2m	C	A	6: 121,654,612	L623M	probably benign	Het
Adamts13	A	G	2: 26,996,583	E938G	possibly damaging	Het
Ahnak	A	G	19: 9,009,449	H2699R	probably benign	Het
Antxrl	G	T	14: 34,070,496		probably null	Het
Apol7c	A	T	15: 77,526,218	V176E	probably damaging	Het
Arid5b	T	C	10: 68,277,947	N87D	possibly damaging	Het
Atp2c1	A	T	9: 105,432,698	I560N	probably damaging	Het
Atp2c2	T	C	8: 119,756,003	F868S	possibly damaging	Het
Blnk	G	C	19: 40,937,678	F326L	probably benign	Het
Ckap2	C	T	8: 22,175,796	V412I	possibly damaging	Het
Clmn	A	G	12: 104,782,022	V422A	probably benign	Het
Ctnnal1	A	G	4: 56,813,856	S638P	probably benign	Het
Cyp2j5	T	C	4: 96,635,815	S327G	probably benign	Het
Dhx38	G	A	8: 109,553,545	T871M	probably damaging	Het
Dmxl1	A	T	18: 49,890,767	K1706*	probably null	Het
Dnah11	A	G	12: 118,015,419	L2648P	possibly damaging	Het
Elf2	G	A	3: 51,308,109	T60I	probably damaging	Het
Fam120b	T	A	17: 15,402,497	C246S	possibly damaging	Het
Fcho2	G	T	13: 98,745,895	T451K	possibly damaging	Het
Fzd9	T	A	5: 135,249,748	I428F	probably damaging	Het
Galnt13	T	A	2: 54,854,655	V122E	probably damaging	Het
Gm21738	T	A	14: 19,418,908	Y8F	probably benign	Het
Gnptab	A	G	10: 88,436,167	I940V	possibly damaging	Het
Gp2	A	G	7: 119,451,498		probably null	Het
Gpr6	A	G	10: 41,070,534	S351P	probably benign	Het
Gprin1	T	C	13: 54,739,876	E195G	possibly damaging	Het
Grm8	A	T	6: 28,125,883	Y81*	probably null	Het
Gtf3c3	A	T	1: 54,405,119	N703K	probably damaging	Het
H2afy	T	A	13: 56,104,909	N87Y	probably damaging	Het
Hhipl2	G	A	1: 183,428,013	V495I	probably benign	Het
Islr	G	A	9: 58,158,219		probably benign	Het
Lrrc36	T	C	8: 105,449,641	Y216H	possibly damaging	Het
Me2	A	G	18: 73,773,134	I528T	probably benign	Het
Mecr	A	T	4: 131,857,816	I156F	possibly damaging	Het
Megf6	A	G	4: 154,262,510		probably benign	Het
Mn1	T	A	5: 111,421,569	L1135H	probably damaging	Het
Naip5	A	G	13: 100,212,669	S1384P	probably damaging	Het
Nav2	A	G	7: 49,452,465	N337S	probably benign	Het
Ndn	C	T	7: 62,348,508	P34L	probably benign	Het
Neb	A	T	2: 52,249,281	H3107Q	probably benign	Het
Nebl	A	G	2: 17,376,651	V738A	possibly damaging	Het
Nsd2	G	A	5: 33,882,120	R825Q	possibly damaging	Het
Nsun2	A	G	13: 69,627,586	N383S	probably damaging	Het
Ntrk3	A	T	7: 78,247,288	M667K	probably damaging	Het
Olfr389	A	G	11: 73,777,148	Y60H	possibly damaging	Het
Olfr514	A	C	7: 108,825,235	C255G	probably benign	Het
Olfr745	G	A	14: 50,643,108	V276M	possibly damaging	Het
Olfr791	A	T	10: 129,526,619	M131L	probably benign	Het
Pex6	T	C	17: 46,722,632	V633A	probably benign	Het
Phactr1	C	T	13: 42,956,671	T95M	probably damaging	Het
Pik3r4	A	G	9: 105,687,209	D1334G	probably damaging	Het
Pkhd1l1	A	C	15: 44,597,117	I4241L	probably benign	Het
Ppwd1	T	C	13: 104,220,263	E248G	probably damaging	Het
Prepl	A	C	17: 85,072,081	M393R	probably benign	Het
Ptpn6	T	C	6: 124,721,185	S532G	probably benign	Het
Rnase11	G	T	14: 51,049,601	H165Q	possibly damaging	Het
Sf1	A	G	19: 6,372,060	N172S	possibly damaging	Het
Shprh	T	A	10: 11,157,078	D269E	probably benign	Het
Slc16a1	T	C	3: 104,649,482	I61T	possibly damaging	Het
Slc38a2	A	C	15: 96,692,536	I309S	probably damaging	Het
Sry	C	G	Y: 2,663,149	Q170H	unknown	Het
Stk3	A	C	15: 35,008,308		probably null	Het
Tg	C	A	15: 66,696,166	C1306*	probably null	Het
Tnik	A	G	3: 28,665,740	M1254V	probably damaging	Het
U2surp	T	C	9: 95,484,227	E474G	possibly damaging	Het
Vmn1r224	T	A	17: 20,419,325	F55I	probably benign	Het
Vmn1r32	A	G	6: 66,552,955	I279T	possibly damaging	Het
Zc2hc1a	A	G	3: 7,516,483	D15G	probably benign	Het
Zfp827	C	A	8: 79,076,346	P516T	possibly damaging	Het
Zfyve9	A	T	4: 108,684,907		probably null	Het

Other mutations in Agfg1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00704:Agfg1	APN	1	82858403	missense	probably damaging	1.00
IGL02066:Agfg1	APN	1	82893558	missense	probably damaging	1.00
IGL02447:Agfg1	APN	1	82882223	splice site	probably benign
R0038:Agfg1	UTSW	1	82886102	splice site	probably benign
R0038:Agfg1	UTSW	1	82886102	splice site	probably benign
R0548:Agfg1	UTSW	1	82886431	missense	probably damaging	0.97
R0962:Agfg1	UTSW	1	82886396	missense	probably damaging	1.00
R1213:Agfg1	UTSW	1	82875334	missense	probably damaging	1.00
R4078:Agfg1	UTSW	1	82882287	missense	possibly damaging	0.94
R4477:Agfg1	UTSW	1	82875340	missense	probably damaging	1.00
R4780:Agfg1	UTSW	1	82886387	missense	probably damaging	1.00
R5103:Agfg1	UTSW	1	82893567	missense	probably damaging	1.00
R5576:Agfg1	UTSW	1	82870724	missense	probably benign	0.01
R5663:Agfg1	UTSW	1	82893452	missense	probably damaging	1.00
R6314:Agfg1	UTSW	1	82858434	missense	probably damaging	1.00
R6699:Agfg1	UTSW	1	82858454	splice site	probably null
R7266:Agfg1	UTSW	1	82882245	missense	probably benign	0.00
R7408:Agfg1	UTSW	1	82882309	missense	probably damaging	1.00
R7474:Agfg1	UTSW	1	82882411	nonsense	probably null
R8737:Agfg1	UTSW	1	82893522	missense	probably benign	0.44
R8884:Agfg1	UTSW	1	82882389	nonsense	probably null
R8887:Agfg1	UTSW	1	82870804	splice site	probably benign
R9034:Agfg1	UTSW	1	82876192	nonsense	probably null
R9060:Agfg1	UTSW	1	82894533	missense	possibly damaging	0.83
R9117:Agfg1	UTSW	1	82894495	missense	possibly damaging	0.85
R9401:Agfg1	UTSW	1	82882237	missense	probably benign	0.18

Predicted Primers

PCR Primer
(F):5'- TGGCTTCTGAAACCAGGCTGTTG -3'
(R):5'- CGCCAAAGGCTCTTCTAGTGTAGG -3'

Sequencing Primer
(F):5'- AAACCAGGCTGTTGTTTGAC -3'
(R):5'- TCTAGTGTAGGTAGTCAACACTGAG -3'

Posted On

2014-04-24