Mutagenetix > Incidental Mutation

Incidental Mutation 'R1638:Nebl'

173281

Institutional Source

Beutler Lab

Gene Symbol

Nebl

Ensembl Gene

ENSMUSG00000053702

Gene Name

nebulette

Synonyms

Lnebl, 1200007O21Rik, A630080F05Rik, D830029A09Rik

MMRRC Submission

039674-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1638 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

17343909-17731464 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 17376651 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 738 (V738A)

Ref Sequence

ENSEMBL: ENSMUSP00000117805 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028080] [ENSMUST00000124270] [ENSMUST00000177966]

AlphaFold

Q0II04

Predicted Effect

probably benign
Transcript: ENSMUST00000028080

SMART Domains

Protein: ENSMUSP00000028080
Gene: ENSMUSG00000053702

Domain	Start	End	E-Value	Type
LIM	4	56	6.95e-14	SMART
NEBU	62	92	3.35e-8	SMART
NEBU	98	128	4.88e-10	SMART
NEBU	134	164	3.82e-3	SMART
SH3	213	270	2.12e-20	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000124270
AA Change: V738A

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000117805
Gene: ENSMUSG00000053702
AA Change: V738A

Domain	Start	End	E-Value	Type
low complexity region	11	25	N/A	INTRINSIC
NEBU	30	60	1.21e-5	SMART
NEBU	65	95	5.4e-3	SMART
NEBU	102	132	4.46e-4	SMART
NEBU	139	169	1.31e-1	SMART
NEBU	173	203	5.4e-3	SMART
NEBU	207	237	2.74e-4	SMART
NEBU	245	275	1.57e0	SMART
NEBU	280	310	9.67e-1	SMART
NEBU	315	345	6.25e-8	SMART
NEBU	351	381	5.97e-5	SMART
NEBU	387	418	2.56e-4	SMART
NEBU	425	455	8.91e-4	SMART
NEBU	462	492	4.92e-6	SMART
NEBU	499	529	2.33e-7	SMART
NEBU	536	566	1.84e-5	SMART
NEBU	571	601	2.23e-4	SMART
NEBU	602	632	1.24e-2	SMART
NEBU	664	694	6.6e-7	SMART
NEBU	695	725	6.86e-5	SMART
NEBU	726	756	2.03e-7	SMART
NEBU	761	791	1.74e-6	SMART
NEBU	797	827	3.82e-3	SMART
SH3	957	1014	2.12e-20	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000124611

SMART Domains

Protein: ENSMUSP00000116065
Gene: ENSMUSG00000053702

Domain	Start	End	E-Value	Type
NEBU	3	33	4.88e-10	SMART
NEBU	39	69	3.82e-3	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127912

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137253

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150194

Predicted Effect

probably benign
Transcript: ENSMUST00000177966

SMART Domains

Protein: ENSMUSP00000137567
Gene: ENSMUSG00000053702

Domain	Start	End	E-Value	Type
NEBU	5	35	2.23e-4	SMART
NEBU	36	66	3.28e-2	SMART
NEBU	67	97	6.6e-7	SMART
NEBU	98	120	2e1	SMART

Meta Mutation Damage Score

0.2793

Coding Region Coverage

1x: 99.0%
3x: 97.9%
10x: 94.9%
20x: 87.8%

Validation Efficiency

99% (79/80)

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	C	T	3: 37,035,812	R4130*	probably null	Het
A2m	C	A	6: 121,654,612	L623M	probably benign	Het
Adamts13	A	G	2: 26,996,583	E938G	possibly damaging	Het
Agfg1	A	T	1: 82,893,538	Q497L	probably damaging	Het
Ahnak	A	G	19: 9,009,449	H2699R	probably benign	Het
Antxrl	G	T	14: 34,070,496		probably null	Het
Apol7c	A	T	15: 77,526,218	V176E	probably damaging	Het
Arid5b	T	C	10: 68,277,947	N87D	possibly damaging	Het
Atp2c1	A	T	9: 105,432,698	I560N	probably damaging	Het
Atp2c2	T	C	8: 119,756,003	F868S	possibly damaging	Het
Blnk	G	C	19: 40,937,678	F326L	probably benign	Het
Ckap2	C	T	8: 22,175,796	V412I	possibly damaging	Het
Clmn	A	G	12: 104,782,022	V422A	probably benign	Het
Ctnnal1	A	G	4: 56,813,856	S638P	probably benign	Het
Cyp2j5	T	C	4: 96,635,815	S327G	probably benign	Het
Dhx38	G	A	8: 109,553,545	T871M	probably damaging	Het
Dmxl1	A	T	18: 49,890,767	K1706*	probably null	Het
Dnah11	A	G	12: 118,015,419	L2648P	possibly damaging	Het
Elf2	G	A	3: 51,308,109	T60I	probably damaging	Het
Fam120b	T	A	17: 15,402,497	C246S	possibly damaging	Het
Fcho2	G	T	13: 98,745,895	T451K	possibly damaging	Het
Fzd9	T	A	5: 135,249,748	I428F	probably damaging	Het
Galnt13	T	A	2: 54,854,655	V122E	probably damaging	Het
Gm21738	T	A	14: 19,418,908	Y8F	probably benign	Het
Gnptab	A	G	10: 88,436,167	I940V	possibly damaging	Het
Gp2	A	G	7: 119,451,498		probably null	Het
Gpr6	A	G	10: 41,070,534	S351P	probably benign	Het
Gprin1	T	C	13: 54,739,876	E195G	possibly damaging	Het
Grm8	A	T	6: 28,125,883	Y81*	probably null	Het
Gtf3c3	A	T	1: 54,405,119	N703K	probably damaging	Het
H2afy	T	A	13: 56,104,909	N87Y	probably damaging	Het
Hhipl2	G	A	1: 183,428,013	V495I	probably benign	Het
Islr	G	A	9: 58,158,219		probably benign	Het
Lrrc36	T	C	8: 105,449,641	Y216H	possibly damaging	Het
Me2	A	G	18: 73,773,134	I528T	probably benign	Het
Mecr	A	T	4: 131,857,816	I156F	possibly damaging	Het
Megf6	A	G	4: 154,262,510		probably benign	Het
Mn1	T	A	5: 111,421,569	L1135H	probably damaging	Het
Naip5	A	G	13: 100,212,669	S1384P	probably damaging	Het
Nav2	A	G	7: 49,452,465	N337S	probably benign	Het
Ndn	C	T	7: 62,348,508	P34L	probably benign	Het
Neb	A	T	2: 52,249,281	H3107Q	probably benign	Het
Nsd2	G	A	5: 33,882,120	R825Q	possibly damaging	Het
Nsun2	A	G	13: 69,627,586	N383S	probably damaging	Het
Ntrk3	A	T	7: 78,247,288	M667K	probably damaging	Het
Olfr389	A	G	11: 73,777,148	Y60H	possibly damaging	Het
Olfr514	A	C	7: 108,825,235	C255G	probably benign	Het
Olfr745	G	A	14: 50,643,108	V276M	possibly damaging	Het
Olfr791	A	T	10: 129,526,619	M131L	probably benign	Het
Pex6	T	C	17: 46,722,632	V633A	probably benign	Het
Phactr1	C	T	13: 42,956,671	T95M	probably damaging	Het
Pik3r4	A	G	9: 105,687,209	D1334G	probably damaging	Het
Pkhd1l1	A	C	15: 44,597,117	I4241L	probably benign	Het
Ppwd1	T	C	13: 104,220,263	E248G	probably damaging	Het
Prepl	A	C	17: 85,072,081	M393R	probably benign	Het
Ptpn6	T	C	6: 124,721,185	S532G	probably benign	Het
Rnase11	G	T	14: 51,049,601	H165Q	possibly damaging	Het
Sf1	A	G	19: 6,372,060	N172S	possibly damaging	Het
Shprh	T	A	10: 11,157,078	D269E	probably benign	Het
Slc16a1	T	C	3: 104,649,482	I61T	possibly damaging	Het
Slc38a2	A	C	15: 96,692,536	I309S	probably damaging	Het
Sry	C	G	Y: 2,663,149	Q170H	unknown	Het
Stk3	A	C	15: 35,008,308		probably null	Het
Tg	C	A	15: 66,696,166	C1306*	probably null	Het
Tnik	A	G	3: 28,665,740	M1254V	probably damaging	Het
U2surp	T	C	9: 95,484,227	E474G	possibly damaging	Het
Vmn1r224	T	A	17: 20,419,325	F55I	probably benign	Het
Vmn1r32	A	G	6: 66,552,955	I279T	possibly damaging	Het
Zc2hc1a	A	G	3: 7,516,483	D15G	probably benign	Het
Zfp827	C	A	8: 79,076,346	P516T	possibly damaging	Het
Zfyve9	A	T	4: 108,684,907		probably null	Het

Other mutations in Nebl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02146:Nebl	APN	2	17348868	missense	probably damaging	0.99
IGL02732:Nebl	APN	2	17452484	splice site	probably benign
IGL03241:Nebl	APN	2	17393164	critical splice donor site	probably null
IGL03334:Nebl	APN	2	17413711	missense	probably damaging	0.98
BB008:Nebl	UTSW	2	17376622	critical splice donor site	probably null
BB018:Nebl	UTSW	2	17376622	critical splice donor site	probably null
R0068:Nebl	UTSW	2	17434971	nonsense	probably null
R0127:Nebl	UTSW	2	17392983	missense	probably benign	0.31
R0128:Nebl	UTSW	2	17393023	missense	possibly damaging	0.65
R0130:Nebl	UTSW	2	17393023	missense	possibly damaging	0.65
R0130:Nebl	UTSW	2	17390926	start gained	probably benign
R0537:Nebl	UTSW	2	17404215	missense	possibly damaging	0.62
R0743:Nebl	UTSW	2	17411118	missense	probably benign
R0884:Nebl	UTSW	2	17411118	missense	probably benign
R1364:Nebl	UTSW	2	17393037	unclassified	probably benign
R1711:Nebl	UTSW	2	17388754	missense	probably damaging	0.96
R1933:Nebl	UTSW	2	17375292	missense	probably damaging	0.97
R1990:Nebl	UTSW	2	17452510	missense	probably damaging	0.98
R1991:Nebl	UTSW	2	17452510	missense	probably damaging	0.98
R1992:Nebl	UTSW	2	17452510	missense	probably damaging	0.98
R2062:Nebl	UTSW	2	17397121	missense	probably benign	0.39
R2183:Nebl	UTSW	2	17404216	missense	probably damaging	0.99
R2325:Nebl	UTSW	2	17393016	missense	possibly damaging	0.79
R2679:Nebl	UTSW	2	17424591	missense	probably benign	0.03
R2877:Nebl	UTSW	2	17434929	missense	probably damaging	0.99
R2878:Nebl	UTSW	2	17434929	missense	probably damaging	0.99
R3079:Nebl	UTSW	2	17376651	missense	possibly damaging	0.94
R3080:Nebl	UTSW	2	17376651	missense	possibly damaging	0.94
R3878:Nebl	UTSW	2	17393252	missense	possibly damaging	0.83
R3947:Nebl	UTSW	2	17378106	critical splice donor site	probably null
R4983:Nebl	UTSW	2	17375271	missense	possibly damaging	0.80
R5006:Nebl	UTSW	2	17388771	splice site	probably null
R5256:Nebl	UTSW	2	17433975	missense	probably benign	0.37
R5491:Nebl	UTSW	2	17434972	nonsense	probably null
R5533:Nebl	UTSW	2	17393268	nonsense	probably null
R5597:Nebl	UTSW	2	17378167	missense	probably benign
R5658:Nebl	UTSW	2	17348852	missense	probably damaging	1.00
R5933:Nebl	UTSW	2	17404187	missense	probably benign
R6056:Nebl	UTSW	2	17450234	missense	probably benign	0.13
R6161:Nebl	UTSW	2	17730830	missense	probably benign	0.26
R6646:Nebl	UTSW	2	17376685	missense	probably damaging	1.00
R6784:Nebl	UTSW	2	17434914	nonsense	probably null
R6935:Nebl	UTSW	2	17348826	missense	probably damaging	1.00
R7196:Nebl	UTSW	2	17452518	missense	probably damaging	1.00
R7671:Nebl	UTSW	2	17390916	nonsense	probably null
R7728:Nebl	UTSW	2	17370514	missense
R7931:Nebl	UTSW	2	17376622	critical splice donor site	probably null
R8007:Nebl	UTSW	2	17370489	missense
R8048:Nebl	UTSW	2	17424522	missense	probably benign	0.12
R8118:Nebl	UTSW	2	17379820	missense	possibly damaging	0.48
R8317:Nebl	UTSW	2	17350757	missense	possibly damaging	0.71
R8349:Nebl	UTSW	2	17413782	missense	probably damaging	0.98
R8360:Nebl	UTSW	2	17460487	missense	probably benign	0.04
R8392:Nebl	UTSW	2	17452552	missense	probably benign	0.36
R8449:Nebl	UTSW	2	17413782	missense	probably damaging	0.98
R8537:Nebl	UTSW	2	17350709	missense	probably benign	0.02
R8778:Nebl	UTSW	2	17404267	missense	probably damaging	1.00
R8893:Nebl	UTSW	2	17730860	start codon destroyed	probably null	1.00
R8894:Nebl	UTSW	2	17375225	missense	probably benign	0.01
R8906:Nebl	UTSW	2	17378117	missense	probably benign	0.18
R8929:Nebl	UTSW	2	17393180	nonsense	probably null
R9054:Nebl	UTSW	2	17411096	missense	possibly damaging	0.72
R9119:Nebl	UTSW	2	17400559	missense	probably damaging	0.96
R9211:Nebl	UTSW	2	17388690	critical splice donor site	probably null
R9225:Nebl	UTSW	2	17400511	missense	possibly damaging	0.70
R9296:Nebl	UTSW	2	17424640	splice site	probably benign
R9310:Nebl	UTSW	2	17348867	missense	probably benign	0.16
R9474:Nebl	UTSW	2	17369610	nonsense	probably null
X0012:Nebl	UTSW	2	17443794	missense	probably benign	0.16
X0025:Nebl	UTSW	2	17404267	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCCGCATGGGGTATGAAATCTACTAAG -3'
(R):5'- ACTGATGATGCACTGGAGCCTGTC -3'

Sequencing Primer
(F):5'- TGCACAGCTTTCCAGAATAACTG -3'
(R):5'- TGAGAAGAGGGACACTCCTATCC -3'

Posted On

2014-04-24