Mutagenetix > Incidental Mutation

Incidental Mutation 'R1638:Nsd2'

173295

Institutional Source

Beutler Lab

Gene Symbol

Nsd2

Ensembl Gene

ENSMUSG00000057406

Gene Name

nuclear receptor binding SET domain protein 2

Synonyms

5830445G22Rik, Whsc1, Whsc1l, C130020C13Rik, 9430010A17Rik, D030027O06Rik, D930023B08Rik

MMRRC Submission

039674-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.876) question?

Stock #

R1638 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

33820725-33897975 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 33882120 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glutamine at position 825 (R825Q)

Ref Sequence

ENSEMBL: ENSMUSP00000075210 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000058096] [ENSMUST00000066854] [ENSMUST00000075812] [ENSMUST00000114399] [ENSMUST00000137191] [ENSMUST00000139845] [ENSMUST00000202525]

AlphaFold

Q8BVE8

Predicted Effect

possibly damaging
Transcript: ENSMUST00000058096
AA Change: R824Q

PolyPhen 2 Score 0.787 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000058940
Gene: ENSMUSG00000057406
AA Change: R824Q

Domain	Start	End	E-Value	Type
low complexity region	12	23	N/A	INTRINSIC
PWWP	220	285	3.84e-15	SMART
low complexity region	397	408	N/A	INTRINSIC
HMG	452	522	7.64e-9	SMART
low complexity region	532	545	N/A	INTRINSIC
low complexity region	629	643	N/A	INTRINSIC
PHD	669	711	1.36e-6	SMART
RING	670	710	1.5e1	SMART
PHD	716	763	6.81e-1	SMART
RING	717	762	5.25e-2	SMART
PHD	833	873	2.35e-10	SMART
PWWP	878	940	2.67e-23	SMART
AWS	1011	1062	3.74e-27	SMART
SET	1063	1186	4.48e-43	SMART
PostSET	1187	1203	7.56e-4	SMART
low complexity region	1215	1236	N/A	INTRINSIC
PHD	1241	1284	1.98e-8	SMART
low complexity region	1347	1360	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000066854
AA Change: R825Q

PolyPhen 2 Score 0.865 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000067205
Gene: ENSMUSG00000057406
AA Change: R825Q

Domain	Start	End	E-Value	Type
low complexity region	12	23	N/A	INTRINSIC
PWWP	220	285	3.84e-15	SMART
low complexity region	397	408	N/A	INTRINSIC
HMG	452	522	7.64e-9	SMART
low complexity region	532	545	N/A	INTRINSIC
low complexity region	630	644	N/A	INTRINSIC
PHD	670	712	1.36e-6	SMART
RING	671	711	1.5e1	SMART
PHD	717	764	6.81e-1	SMART
RING	718	763	5.25e-2	SMART
PHD	834	874	2.35e-10	SMART
PWWP	879	941	2.67e-23	SMART
AWS	1012	1063	3.74e-27	SMART
SET	1064	1187	4.48e-43	SMART
PostSET	1188	1204	7.56e-4	SMART
low complexity region	1216	1237	N/A	INTRINSIC
PHD	1242	1285	1.98e-8	SMART
low complexity region	1348	1361	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000075812
AA Change: R825Q

PolyPhen 2 Score 0.865 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000075210
Gene: ENSMUSG00000057406
AA Change: R825Q

Domain	Start	End	E-Value	Type
low complexity region	12	23	N/A	INTRINSIC
PWWP	220	285	3.84e-15	SMART
low complexity region	397	408	N/A	INTRINSIC
HMG	452	522	7.64e-9	SMART
low complexity region	532	545	N/A	INTRINSIC
low complexity region	630	644	N/A	INTRINSIC
PHD	670	712	1.36e-6	SMART
RING	671	711	1.5e1	SMART
PHD	717	764	6.81e-1	SMART
RING	718	763	5.25e-2	SMART
PHD	834	874	2.35e-10	SMART
PWWP	879	941	2.67e-23	SMART
AWS	1012	1063	3.74e-27	SMART
SET	1064	1187	4.48e-43	SMART
PostSET	1188	1204	7.56e-4	SMART
low complexity region	1216	1237	N/A	INTRINSIC
PHD	1242	1285	1.98e-8	SMART
low complexity region	1348	1361	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000114399

SMART Domains

Protein: ENSMUSP00000110041
Gene: ENSMUSG00000057406

Domain	Start	End	E-Value	Type
low complexity region	12	23	N/A	INTRINSIC
Pfam:PWWP	220	332	4.9e-26	PFAM
low complexity region	397	408	N/A	INTRINSIC
HMG	452	522	7.64e-9	SMART
low complexity region	532	545	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133870

Predicted Effect

probably benign
Transcript: ENSMUST00000137191

SMART Domains

Protein: ENSMUSP00000122310
Gene: ENSMUSG00000057406

Domain	Start	End	E-Value	Type
low complexity region	12	23	N/A	INTRINSIC
Pfam:PWWP	220	332	4.9e-26	PFAM
low complexity region	397	408	N/A	INTRINSIC
HMG	452	522	7.64e-9	SMART
low complexity region	532	545	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000139845

SMART Domains

Protein: ENSMUSP00000123460
Gene: ENSMUSG00000057406

Domain	Start	End	E-Value	Type
low complexity region	12	23	N/A	INTRINSIC
Pfam:PWWP	220	332	4.9e-26	PFAM
low complexity region	397	408	N/A	INTRINSIC
HMG	452	522	7.64e-9	SMART
low complexity region	532	545	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000141416

SMART Domains

Protein: ENSMUSP00000117233
Gene: ENSMUSG00000057406

Domain	Start	End	E-Value	Type
Pfam:PWWP	202	314	1.1e-25	PFAM
low complexity region	379	390	N/A	INTRINSIC
HMG	434	504	4.7e-9	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000142080

SMART Domains

Protein: ENSMUSP00000115251
Gene: ENSMUSG00000057406

Domain	Start	End	E-Value	Type
Blast:SET	2	148	7e-47	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000200981

Predicted Effect

possibly damaging
Transcript: ENSMUST00000202525
AA Change: R166Q

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000144255
Gene: ENSMUSG00000057406
AA Change: R166Q

Domain	Start	End	E-Value	Type
PHD	11	53	8.5e-9	SMART
RING	12	52	7.3e-2	SMART
PHD	58	105	4.4e-3	SMART
RING	59	104	2.6e-4	SMART
PHD	175	215	1.5e-12	SMART
low complexity region	248	259	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202912

Meta Mutation Damage Score

0.1150

Coding Region Coverage

1x: 99.0%
3x: 97.9%
10x: 94.9%
20x: 87.8%

Validation Efficiency

99% (79/80)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains four domains present in other developmental proteins: a PWWP domain, an HMG box, a SET domain, and a PHD-type zinc finger. It is expressed ubiquitously in early development. Wolf-Hirschhorn syndrome (WHS) is a malformation syndrome associated with a hemizygous deletion of the distal short arm of chromosome 4. This gene maps to the 165 kb WHS critical region and has also been involved in the chromosomal translocation t(4;14)(p16.3;q32.3) in multiple myelomas. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. Some transcript variants are nonsense-mediated mRNA (NMD) decay candidates, hence not represented as reference sequences. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display reduced fetal size, failed sternum ossification, cleft palate, atrial and ventricular septal defects, stunted growth and postnatal death. Some heterozygotes show severe growth defects, malocclusion, delayed sternum ossification and hypoplasia of the septum secundum. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	C	T	3: 37,035,812	R4130*	probably null	Het
A2m	C	A	6: 121,654,612	L623M	probably benign	Het
Adamts13	A	G	2: 26,996,583	E938G	possibly damaging	Het
Agfg1	A	T	1: 82,893,538	Q497L	probably damaging	Het
Ahnak	A	G	19: 9,009,449	H2699R	probably benign	Het
Antxrl	G	T	14: 34,070,496		probably null	Het
Apol7c	A	T	15: 77,526,218	V176E	probably damaging	Het
Arid5b	T	C	10: 68,277,947	N87D	possibly damaging	Het
Atp2c1	A	T	9: 105,432,698	I560N	probably damaging	Het
Atp2c2	T	C	8: 119,756,003	F868S	possibly damaging	Het
Blnk	G	C	19: 40,937,678	F326L	probably benign	Het
Ckap2	C	T	8: 22,175,796	V412I	possibly damaging	Het
Clmn	A	G	12: 104,782,022	V422A	probably benign	Het
Ctnnal1	A	G	4: 56,813,856	S638P	probably benign	Het
Cyp2j5	T	C	4: 96,635,815	S327G	probably benign	Het
Dhx38	G	A	8: 109,553,545	T871M	probably damaging	Het
Dmxl1	A	T	18: 49,890,767	K1706*	probably null	Het
Dnah11	A	G	12: 118,015,419	L2648P	possibly damaging	Het
Elf2	G	A	3: 51,308,109	T60I	probably damaging	Het
Fam120b	T	A	17: 15,402,497	C246S	possibly damaging	Het
Fcho2	G	T	13: 98,745,895	T451K	possibly damaging	Het
Fzd9	T	A	5: 135,249,748	I428F	probably damaging	Het
Galnt13	T	A	2: 54,854,655	V122E	probably damaging	Het
Gm21738	T	A	14: 19,418,908	Y8F	probably benign	Het
Gnptab	A	G	10: 88,436,167	I940V	possibly damaging	Het
Gp2	A	G	7: 119,451,498		probably null	Het
Gpr6	A	G	10: 41,070,534	S351P	probably benign	Het
Gprin1	T	C	13: 54,739,876	E195G	possibly damaging	Het
Grm8	A	T	6: 28,125,883	Y81*	probably null	Het
Gtf3c3	A	T	1: 54,405,119	N703K	probably damaging	Het
H2afy	T	A	13: 56,104,909	N87Y	probably damaging	Het
Hhipl2	G	A	1: 183,428,013	V495I	probably benign	Het
Islr	G	A	9: 58,158,219		probably benign	Het
Lrrc36	T	C	8: 105,449,641	Y216H	possibly damaging	Het
Me2	A	G	18: 73,773,134	I528T	probably benign	Het
Mecr	A	T	4: 131,857,816	I156F	possibly damaging	Het
Megf6	A	G	4: 154,262,510		probably benign	Het
Mn1	T	A	5: 111,421,569	L1135H	probably damaging	Het
Naip5	A	G	13: 100,212,669	S1384P	probably damaging	Het
Nav2	A	G	7: 49,452,465	N337S	probably benign	Het
Ndn	C	T	7: 62,348,508	P34L	probably benign	Het
Neb	A	T	2: 52,249,281	H3107Q	probably benign	Het
Nebl	A	G	2: 17,376,651	V738A	possibly damaging	Het
Nsun2	A	G	13: 69,627,586	N383S	probably damaging	Het
Ntrk3	A	T	7: 78,247,288	M667K	probably damaging	Het
Olfr389	A	G	11: 73,777,148	Y60H	possibly damaging	Het
Olfr514	A	C	7: 108,825,235	C255G	probably benign	Het
Olfr745	G	A	14: 50,643,108	V276M	possibly damaging	Het
Olfr791	A	T	10: 129,526,619	M131L	probably benign	Het
Pex6	T	C	17: 46,722,632	V633A	probably benign	Het
Phactr1	C	T	13: 42,956,671	T95M	probably damaging	Het
Pik3r4	A	G	9: 105,687,209	D1334G	probably damaging	Het
Pkhd1l1	A	C	15: 44,597,117	I4241L	probably benign	Het
Ppwd1	T	C	13: 104,220,263	E248G	probably damaging	Het
Prepl	A	C	17: 85,072,081	M393R	probably benign	Het
Ptpn6	T	C	6: 124,721,185	S532G	probably benign	Het
Rnase11	G	T	14: 51,049,601	H165Q	possibly damaging	Het
Sf1	A	G	19: 6,372,060	N172S	possibly damaging	Het
Shprh	T	A	10: 11,157,078	D269E	probably benign	Het
Slc16a1	T	C	3: 104,649,482	I61T	possibly damaging	Het
Slc38a2	A	C	15: 96,692,536	I309S	probably damaging	Het
Sry	C	G	Y: 2,663,149	Q170H	unknown	Het
Stk3	A	C	15: 35,008,308		probably null	Het
Tg	C	A	15: 66,696,166	C1306*	probably null	Het
Tnik	A	G	3: 28,665,740	M1254V	probably damaging	Het
U2surp	T	C	9: 95,484,227	E474G	possibly damaging	Het
Vmn1r224	T	A	17: 20,419,325	F55I	probably benign	Het
Vmn1r32	A	G	6: 66,552,955	I279T	possibly damaging	Het
Zc2hc1a	A	G	3: 7,516,483	D15G	probably benign	Het
Zfp827	C	A	8: 79,076,346	P516T	possibly damaging	Het
Zfyve9	A	T	4: 108,684,907		probably null	Het

Other mutations in Nsd2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00391:Nsd2	APN	5	33855733	missense	probably damaging	1.00
IGL00420:Nsd2	APN	5	33883003	missense	possibly damaging	0.82
IGL01343:Nsd2	APN	5	33843578	missense	probably damaging	1.00
IGL01403:Nsd2	APN	5	33885378	splice site	probably benign
IGL01446:Nsd2	APN	5	33861186	splice site	probably benign
IGL01571:Nsd2	APN	5	33864687	missense	probably benign	0.32
IGL01862:Nsd2	APN	5	33843736	missense	probably null	1.00
IGL02040:Nsd2	APN	5	33867571	splice site	probably benign
IGL02528:Nsd2	APN	5	33879051	unclassified	probably benign
IGL02553:Nsd2	APN	5	33846198	missense	probably damaging	1.00
IGL02799:Nsd2	APN	5	33864788	splice site	probably benign
IGL02932:Nsd2	APN	5	33880128	missense	probably damaging	1.00
Badminton	UTSW	5	33882147	nonsense	probably null
Game	UTSW	5	33885472	missense	probably damaging	1.00
Match	UTSW	5	33879110	missense	probably damaging	1.00
Navratilova	UTSW	5	33885490	missense	probably damaging	0.97
Racquet	UTSW	5	33882845	missense	probably damaging	1.00
serve	UTSW	5	33879111	missense	possibly damaging	0.95
Tennis	UTSW	5	33843513	missense	probably damaging	1.00
R0136:Nsd2	UTSW	5	33855536	missense	possibly damaging	0.89
R0372:Nsd2	UTSW	5	33891551	missense	probably damaging	0.98
R0521:Nsd2	UTSW	5	33843338	missense	probably damaging	1.00
R0548:Nsd2	UTSW	5	33893538	missense	probably damaging	1.00
R0726:Nsd2	UTSW	5	33861028	unclassified	probably benign
R1018:Nsd2	UTSW	5	33843241	missense	probably damaging	1.00
R1649:Nsd2	UTSW	5	33854640	missense	probably damaging	0.98
R1675:Nsd2	UTSW	5	33861149	missense	probably benign	0.04
R1900:Nsd2	UTSW	5	33846169	missense	probably benign
R2001:Nsd2	UTSW	5	33843402	missense	probably damaging	1.00
R2167:Nsd2	UTSW	5	33882919	missense	probably damaging	1.00
R2261:Nsd2	UTSW	5	33885527	missense	probably damaging	1.00
R2966:Nsd2	UTSW	5	33846122	missense	probably benign	0.01
R3931:Nsd2	UTSW	5	33846117	missense	probably benign	0.01
R4429:Nsd2	UTSW	5	33843202	missense	probably damaging	1.00
R4596:Nsd2	UTSW	5	33882918	missense	probably damaging	1.00
R4958:Nsd2	UTSW	5	33892022	missense	probably damaging	1.00
R5346:Nsd2	UTSW	5	33879136	missense	possibly damaging	0.94
R5957:Nsd2	UTSW	5	33855603	missense	probably damaging	1.00
R6054:Nsd2	UTSW	5	33882161	missense	probably damaging	1.00
R6124:Nsd2	UTSW	5	33843266	missense	probably benign	0.08
R6302:Nsd2	UTSW	5	33867577	missense	possibly damaging	0.93
R6390:Nsd2	UTSW	5	33881181	missense	probably damaging	1.00
R6496:Nsd2	UTSW	5	33843513	missense	probably damaging	1.00
R6828:Nsd2	UTSW	5	33893568	missense	probably damaging	0.98
R6925:Nsd2	UTSW	5	33879110	missense	probably damaging	1.00
R7148:Nsd2	UTSW	5	33885511	missense	possibly damaging	0.57
R7311:Nsd2	UTSW	5	33892036	missense	probably damaging	1.00
R7337:Nsd2	UTSW	5	33885472	missense	probably damaging	1.00
R7466:Nsd2	UTSW	5	33882147	nonsense	probably null
R7567:Nsd2	UTSW	5	33846226	missense	probably damaging	0.99
R7704:Nsd2	UTSW	5	33871467	makesense	probably null
R7822:Nsd2	UTSW	5	33843594	missense	probably damaging	0.97
R7939:Nsd2	UTSW	5	33855589	missense	probably benign	0.22
R8127:Nsd2	UTSW	5	33885490	missense	probably damaging	0.97
R8485:Nsd2	UTSW	5	33882845	missense	probably damaging	1.00
R8782:Nsd2	UTSW	5	33843141	start codon destroyed	probably benign
R8783:Nsd2	UTSW	5	33879111	missense	possibly damaging	0.95
R8845:Nsd2	UTSW	5	33882541	missense	probably damaging	1.00
R9034:Nsd2	UTSW	5	33880134	missense	possibly damaging	0.92
R9183:Nsd2	UTSW	5	33871452	missense	probably damaging	0.99
R9283:Nsd2	UTSW	5	33843714	missense	probably benign	0.34
R9438:Nsd2	UTSW	5	33843288	missense	probably damaging	0.99
R9486:Nsd2	UTSW	5	33861149	missense	probably benign	0.04
R9792:Nsd2	UTSW	5	33846145	missense	possibly damaging	0.89
R9793:Nsd2	UTSW	5	33846145	missense	possibly damaging	0.89
R9795:Nsd2	UTSW	5	33846145	missense	possibly damaging	0.89
X0020:Nsd2	UTSW	5	33854757	missense	probably damaging	1.00
Z1088:Nsd2	UTSW	5	33855738	critical splice donor site	probably null
Z1177:Nsd2	UTSW	5	33855520	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CACAGGGCTTCTCTGCCAAGATAC -3'
(R):5'- CCGTGAGTCAACACTCAATGGCATC -3'

Sequencing Primer
(F):5'- GGCTTCTCTGCCAAGATACATTTAG -3'
(R):5'- TGGCATCACTTTACCAAAGTCATC -3'

Posted On

2014-04-24