Incidental Mutation 'R1638:Nsd2'
ID173295
Institutional Source Beutler Lab
Gene Symbol Nsd2
Ensembl Gene ENSMUSG00000057406
Gene Namenuclear receptor binding SET domain protein 2
Synonyms5830445G22Rik, Whsc1, Whsc1l, C130020C13Rik, 9430010A17Rik, D030027O06Rik, D930023B08Rik
MMRRC Submission 039674-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.800) question?
Stock #R1638 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location33820725-33897975 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 33882120 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 825 (R825Q)
Ref Sequence ENSEMBL: ENSMUSP00000075210 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058096] [ENSMUST00000066854] [ENSMUST00000075812] [ENSMUST00000114399] [ENSMUST00000137191] [ENSMUST00000139845] [ENSMUST00000202525]
Predicted Effect possibly damaging
Transcript: ENSMUST00000058096
AA Change: R824Q

PolyPhen 2 Score 0.787 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000058940
Gene: ENSMUSG00000057406
AA Change: R824Q

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
PWWP 220 285 3.84e-15 SMART
low complexity region 397 408 N/A INTRINSIC
HMG 452 522 7.64e-9 SMART
low complexity region 532 545 N/A INTRINSIC
low complexity region 629 643 N/A INTRINSIC
PHD 669 711 1.36e-6 SMART
RING 670 710 1.5e1 SMART
PHD 716 763 6.81e-1 SMART
RING 717 762 5.25e-2 SMART
PHD 833 873 2.35e-10 SMART
PWWP 878 940 2.67e-23 SMART
AWS 1011 1062 3.74e-27 SMART
SET 1063 1186 4.48e-43 SMART
PostSET 1187 1203 7.56e-4 SMART
low complexity region 1215 1236 N/A INTRINSIC
PHD 1241 1284 1.98e-8 SMART
low complexity region 1347 1360 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000066854
AA Change: R825Q

PolyPhen 2 Score 0.865 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000067205
Gene: ENSMUSG00000057406
AA Change: R825Q

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
PWWP 220 285 3.84e-15 SMART
low complexity region 397 408 N/A INTRINSIC
HMG 452 522 7.64e-9 SMART
low complexity region 532 545 N/A INTRINSIC
low complexity region 630 644 N/A INTRINSIC
PHD 670 712 1.36e-6 SMART
RING 671 711 1.5e1 SMART
PHD 717 764 6.81e-1 SMART
RING 718 763 5.25e-2 SMART
PHD 834 874 2.35e-10 SMART
PWWP 879 941 2.67e-23 SMART
AWS 1012 1063 3.74e-27 SMART
SET 1064 1187 4.48e-43 SMART
PostSET 1188 1204 7.56e-4 SMART
low complexity region 1216 1237 N/A INTRINSIC
PHD 1242 1285 1.98e-8 SMART
low complexity region 1348 1361 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000075812
AA Change: R825Q

PolyPhen 2 Score 0.865 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000075210
Gene: ENSMUSG00000057406
AA Change: R825Q

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
PWWP 220 285 3.84e-15 SMART
low complexity region 397 408 N/A INTRINSIC
HMG 452 522 7.64e-9 SMART
low complexity region 532 545 N/A INTRINSIC
low complexity region 630 644 N/A INTRINSIC
PHD 670 712 1.36e-6 SMART
RING 671 711 1.5e1 SMART
PHD 717 764 6.81e-1 SMART
RING 718 763 5.25e-2 SMART
PHD 834 874 2.35e-10 SMART
PWWP 879 941 2.67e-23 SMART
AWS 1012 1063 3.74e-27 SMART
SET 1064 1187 4.48e-43 SMART
PostSET 1188 1204 7.56e-4 SMART
low complexity region 1216 1237 N/A INTRINSIC
PHD 1242 1285 1.98e-8 SMART
low complexity region 1348 1361 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114399
SMART Domains Protein: ENSMUSP00000110041
Gene: ENSMUSG00000057406

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
Pfam:PWWP 220 332 4.9e-26 PFAM
low complexity region 397 408 N/A INTRINSIC
HMG 452 522 7.64e-9 SMART
low complexity region 532 545 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133870
Predicted Effect probably benign
Transcript: ENSMUST00000137191
SMART Domains Protein: ENSMUSP00000122310
Gene: ENSMUSG00000057406

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
Pfam:PWWP 220 332 4.9e-26 PFAM
low complexity region 397 408 N/A INTRINSIC
HMG 452 522 7.64e-9 SMART
low complexity region 532 545 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139845
SMART Domains Protein: ENSMUSP00000123460
Gene: ENSMUSG00000057406

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
Pfam:PWWP 220 332 4.9e-26 PFAM
low complexity region 397 408 N/A INTRINSIC
HMG 452 522 7.64e-9 SMART
low complexity region 532 545 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141416
SMART Domains Protein: ENSMUSP00000117233
Gene: ENSMUSG00000057406

DomainStartEndE-ValueType
Pfam:PWWP 202 314 1.1e-25 PFAM
low complexity region 379 390 N/A INTRINSIC
HMG 434 504 4.7e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142080
SMART Domains Protein: ENSMUSP00000115251
Gene: ENSMUSG00000057406

DomainStartEndE-ValueType
Blast:SET 2 148 7e-47 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200981
Predicted Effect possibly damaging
Transcript: ENSMUST00000202525
AA Change: R166Q

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000144255
Gene: ENSMUSG00000057406
AA Change: R166Q

DomainStartEndE-ValueType
PHD 11 53 8.5e-9 SMART
RING 12 52 7.3e-2 SMART
PHD 58 105 4.4e-3 SMART
RING 59 104 2.6e-4 SMART
PHD 175 215 1.5e-12 SMART
low complexity region 248 259 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202912
Meta Mutation Damage Score 0.1150 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 94.9%
  • 20x: 87.8%
Validation Efficiency 99% (79/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains four domains present in other developmental proteins: a PWWP domain, an HMG box, a SET domain, and a PHD-type zinc finger. It is expressed ubiquitously in early development. Wolf-Hirschhorn syndrome (WHS) is a malformation syndrome associated with a hemizygous deletion of the distal short arm of chromosome 4. This gene maps to the 165 kb WHS critical region and has also been involved in the chromosomal translocation t(4;14)(p16.3;q32.3) in multiple myelomas. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. Some transcript variants are nonsense-mediated mRNA (NMD) decay candidates, hence not represented as reference sequences. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display reduced fetal size, failed sternum ossification, cleft palate, atrial and ventricular septal defects, stunted growth and postnatal death. Some heterozygotes show severe growth defects, malocclusion, delayed sternum ossification and hypoplasia of the septum secundum. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik C T 3: 37,035,812 R4130* probably null Het
A2m C A 6: 121,654,612 L623M probably benign Het
Adamts13 A G 2: 26,996,583 E938G possibly damaging Het
Agfg1 A T 1: 82,893,538 Q497L probably damaging Het
Ahnak A G 19: 9,009,449 H2699R probably benign Het
Antxrl G T 14: 34,070,496 probably null Het
Apol7c A T 15: 77,526,218 V176E probably damaging Het
Arid5b T C 10: 68,277,947 N87D possibly damaging Het
Atp2c1 A T 9: 105,432,698 I560N probably damaging Het
Atp2c2 T C 8: 119,756,003 F868S possibly damaging Het
Blnk G C 19: 40,937,678 F326L probably benign Het
Ckap2 C T 8: 22,175,796 V412I possibly damaging Het
Clmn A G 12: 104,782,022 V422A probably benign Het
Ctnnal1 A G 4: 56,813,856 S638P probably benign Het
Cyp2j5 T C 4: 96,635,815 S327G probably benign Het
Dhx38 G A 8: 109,553,545 T871M probably damaging Het
Dmxl1 A T 18: 49,890,767 K1706* probably null Het
Dnah11 A G 12: 118,015,419 L2648P possibly damaging Het
Elf2 G A 3: 51,308,109 T60I probably damaging Het
Fam120b T A 17: 15,402,497 C246S possibly damaging Het
Fcho2 G T 13: 98,745,895 T451K possibly damaging Het
Fzd9 T A 5: 135,249,748 I428F probably damaging Het
Galnt13 T A 2: 54,854,655 V122E probably damaging Het
Gm21738 T A 14: 19,418,908 Y8F probably benign Het
Gnptab A G 10: 88,436,167 I940V possibly damaging Het
Gp2 A G 7: 119,451,498 probably null Het
Gpr6 A G 10: 41,070,534 S351P probably benign Het
Gprin1 T C 13: 54,739,876 E195G possibly damaging Het
Grm8 A T 6: 28,125,883 Y81* probably null Het
Gtf3c3 A T 1: 54,405,119 N703K probably damaging Het
H2afy T A 13: 56,104,909 N87Y probably damaging Het
Hhipl2 G A 1: 183,428,013 V495I probably benign Het
Islr G A 9: 58,158,219 probably benign Het
Lrrc36 T C 8: 105,449,641 Y216H possibly damaging Het
Me2 A G 18: 73,773,134 I528T probably benign Het
Mecr A T 4: 131,857,816 I156F possibly damaging Het
Megf6 A G 4: 154,262,510 probably benign Het
Mn1 T A 5: 111,421,569 L1135H probably damaging Het
Naip5 A G 13: 100,212,669 S1384P probably damaging Het
Nav2 A G 7: 49,452,465 N337S probably benign Het
Ndn C T 7: 62,348,508 P34L probably benign Het
Neb A T 2: 52,249,281 H3107Q probably benign Het
Nebl A G 2: 17,376,651 V738A possibly damaging Het
Nsun2 A G 13: 69,627,586 N383S probably damaging Het
Ntrk3 A T 7: 78,247,288 M667K probably damaging Het
Olfr389 A G 11: 73,777,148 Y60H possibly damaging Het
Olfr514 A C 7: 108,825,235 C255G probably benign Het
Olfr745 G A 14: 50,643,108 V276M possibly damaging Het
Olfr791 A T 10: 129,526,619 M131L probably benign Het
Pex6 T C 17: 46,722,632 V633A probably benign Het
Phactr1 C T 13: 42,956,671 T95M probably damaging Het
Pik3r4 A G 9: 105,687,209 D1334G probably damaging Het
Pkhd1l1 A C 15: 44,597,117 I4241L probably benign Het
Ppwd1 T C 13: 104,220,263 E248G probably damaging Het
Prepl A C 17: 85,072,081 M393R probably benign Het
Ptpn6 T C 6: 124,721,185 S532G probably benign Het
Rnase11 G T 14: 51,049,601 H165Q possibly damaging Het
Sf1 A G 19: 6,372,060 N172S possibly damaging Het
Shprh T A 10: 11,157,078 D269E probably benign Het
Slc16a1 T C 3: 104,649,482 I61T possibly damaging Het
Slc38a2 A C 15: 96,692,536 I309S probably damaging Het
Sry C G Y: 2,663,149 Q170H unknown Het
Stk3 A C 15: 35,008,308 probably null Het
Tg C A 15: 66,696,166 C1306* probably null Het
Tnik A G 3: 28,665,740 M1254V probably damaging Het
U2surp T C 9: 95,484,227 E474G possibly damaging Het
Vmn1r224 T A 17: 20,419,325 F55I probably benign Het
Vmn1r32 A G 6: 66,552,955 I279T possibly damaging Het
Zc2hc1a A G 3: 7,516,483 D15G probably benign Het
Zfp827 C A 8: 79,076,346 P516T possibly damaging Het
Zfyve9 A T 4: 108,684,907 probably null Het
Other mutations in Nsd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00391:Nsd2 APN 5 33855733 missense probably damaging 1.00
IGL00420:Nsd2 APN 5 33883003 missense possibly damaging 0.82
IGL01343:Nsd2 APN 5 33843578 missense probably damaging 1.00
IGL01403:Nsd2 APN 5 33885378 splice site probably benign
IGL01446:Nsd2 APN 5 33861186 splice site probably benign
IGL01571:Nsd2 APN 5 33864687 missense probably benign 0.32
IGL01862:Nsd2 APN 5 33843736 missense probably null 1.00
IGL02040:Nsd2 APN 5 33867571 splice site probably benign
IGL02528:Nsd2 APN 5 33879051 unclassified probably benign
IGL02553:Nsd2 APN 5 33846198 missense probably damaging 1.00
IGL02799:Nsd2 APN 5 33864788 splice site probably benign
IGL02932:Nsd2 APN 5 33880128 missense probably damaging 1.00
Tennis UTSW 5 33843513 missense probably damaging 1.00
R0136:Nsd2 UTSW 5 33855536 missense possibly damaging 0.89
R0372:Nsd2 UTSW 5 33891551 missense probably damaging 0.98
R0521:Nsd2 UTSW 5 33843338 missense probably damaging 1.00
R0548:Nsd2 UTSW 5 33893538 missense probably damaging 1.00
R0726:Nsd2 UTSW 5 33861028 unclassified probably benign
R1018:Nsd2 UTSW 5 33843241 missense probably damaging 1.00
R1649:Nsd2 UTSW 5 33854640 missense probably damaging 0.98
R1675:Nsd2 UTSW 5 33861149 missense probably benign 0.04
R1900:Nsd2 UTSW 5 33846169 missense probably benign
R2001:Nsd2 UTSW 5 33843402 missense probably damaging 1.00
R2167:Nsd2 UTSW 5 33882919 missense probably damaging 1.00
R2261:Nsd2 UTSW 5 33885527 missense probably damaging 1.00
R2966:Nsd2 UTSW 5 33846122 missense probably benign 0.01
R3931:Nsd2 UTSW 5 33846117 missense probably benign 0.01
R4429:Nsd2 UTSW 5 33843202 missense probably damaging 1.00
R4596:Nsd2 UTSW 5 33882918 missense probably damaging 1.00
R4958:Nsd2 UTSW 5 33892022 missense probably damaging 1.00
R5346:Nsd2 UTSW 5 33879136 missense possibly damaging 0.94
R5957:Nsd2 UTSW 5 33855603 missense probably damaging 1.00
R6054:Nsd2 UTSW 5 33882161 missense probably damaging 1.00
R6124:Nsd2 UTSW 5 33843266 missense probably benign 0.08
R6302:Nsd2 UTSW 5 33867577 missense possibly damaging 0.93
R6390:Nsd2 UTSW 5 33881181 missense probably damaging 1.00
R6496:Nsd2 UTSW 5 33843513 missense probably damaging 1.00
R6828:Nsd2 UTSW 5 33893568 missense probably damaging 0.98
R6925:Nsd2 UTSW 5 33879110 missense probably damaging 1.00
R7148:Nsd2 UTSW 5 33885511 missense possibly damaging 0.57
R7311:Nsd2 UTSW 5 33892036 missense probably damaging 1.00
R7337:Nsd2 UTSW 5 33885472 missense probably damaging 1.00
R7466:Nsd2 UTSW 5 33882147 nonsense probably null
R7567:Nsd2 UTSW 5 33846226 missense probably damaging 0.99
R7704:Nsd2 UTSW 5 33871467 makesense probably null
R7822:Nsd2 UTSW 5 33843594 missense probably damaging 0.97
X0020:Nsd2 UTSW 5 33854757 missense probably damaging 1.00
Z1088:Nsd2 UTSW 5 33855738 critical splice donor site probably null
Z1177:Nsd2 UTSW 5 33855520 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACAGGGCTTCTCTGCCAAGATAC -3'
(R):5'- CCGTGAGTCAACACTCAATGGCATC -3'

Sequencing Primer
(F):5'- GGCTTCTCTGCCAAGATACATTTAG -3'
(R):5'- TGGCATCACTTTACCAAAGTCATC -3'
Posted On2014-04-24