Incidental Mutation 'R1638:Mn1'
ID173296
Institutional Source Beutler Lab
Gene Symbol Mn1
Ensembl Gene ENSMUSG00000070576
Gene Namemeningioma 1
Synonyms
MMRRC Submission 039674-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1638 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location111417362-111457033 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 111421569 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 1135 (L1135H)
Ref Sequence ENSEMBL: ENSMUSP00000092034 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094463]
Predicted Effect probably damaging
Transcript: ENSMUST00000094463
AA Change: L1135H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000092034
Gene: ENSMUSG00000070576
AA Change: L1135H

DomainStartEndE-ValueType
low complexity region 92 124 N/A INTRINSIC
low complexity region 128 144 N/A INTRINSIC
low complexity region 201 217 N/A INTRINSIC
low complexity region 291 303 N/A INTRINSIC
low complexity region 333 354 N/A INTRINSIC
coiled coil region 507 548 N/A INTRINSIC
low complexity region 551 565 N/A INTRINSIC
low complexity region 569 584 N/A INTRINSIC
low complexity region 643 657 N/A INTRINSIC
low complexity region 685 704 N/A INTRINSIC
low complexity region 708 725 N/A INTRINSIC
low complexity region 727 738 N/A INTRINSIC
low complexity region 745 771 N/A INTRINSIC
low complexity region 780 791 N/A INTRINSIC
low complexity region 862 892 N/A INTRINSIC
low complexity region 913 933 N/A INTRINSIC
low complexity region 957 972 N/A INTRINSIC
low complexity region 1098 1110 N/A INTRINSIC
low complexity region 1134 1145 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138784
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196957
Meta Mutation Damage Score 0.172 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 94.9%
  • 20x: 87.8%
Validation Efficiency 99% (79/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Meningioma 1 (MN1) contains two sets of CAG repeats. It is disrupted by a balanced translocation (4;22) in a meningioma, and its inactivation may contribute to meningioma 32 pathogenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice die shortly after birth due to cleft palate. Development of several bones in the skull was abnormal with completely absent alisphenoid, squamosal, and vomer bones, hypoplastic basisphenoid, pterygoid, and presphenoid bones, and thinfrontal, parietal, and interparietal bones. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik C T 3: 37,035,812 R4130* probably null Het
A2m C A 6: 121,654,612 L623M probably benign Het
Adamts13 A G 2: 26,996,583 E938G possibly damaging Het
Agfg1 A T 1: 82,893,538 Q497L probably damaging Het
Ahnak A G 19: 9,009,449 H2699R probably benign Het
Antxrl G T 14: 34,070,496 probably null Het
Apol7c A T 15: 77,526,218 V176E probably damaging Het
Arid5b T C 10: 68,277,947 N87D possibly damaging Het
Atp2c1 A T 9: 105,432,698 I560N probably damaging Het
Atp2c2 T C 8: 119,756,003 F868S possibly damaging Het
Blnk G C 19: 40,937,678 F326L probably benign Het
Ckap2 C T 8: 22,175,796 V412I possibly damaging Het
Clmn A G 12: 104,782,022 V422A probably benign Het
Ctnnal1 A G 4: 56,813,856 S638P probably benign Het
Cyp2j5 T C 4: 96,635,815 S327G probably benign Het
Dhx38 G A 8: 109,553,545 T871M probably damaging Het
Dmxl1 A T 18: 49,890,767 K1706* probably null Het
Dnah11 A G 12: 118,015,419 L2648P possibly damaging Het
Elf2 G A 3: 51,308,109 T60I probably damaging Het
Fam120b T A 17: 15,402,497 C246S possibly damaging Het
Fcho2 G T 13: 98,745,895 T451K possibly damaging Het
Fzd9 T A 5: 135,249,748 I428F probably damaging Het
Galnt13 T A 2: 54,854,655 V122E probably damaging Het
Gm21738 T A 14: 19,418,908 Y8F probably benign Het
Gnptab A G 10: 88,436,167 I940V possibly damaging Het
Gp2 A G 7: 119,451,498 probably null Het
Gpr6 A G 10: 41,070,534 S351P probably benign Het
Gprin1 T C 13: 54,739,876 E195G possibly damaging Het
Grm8 A T 6: 28,125,883 Y81* probably null Het
Gtf3c3 A T 1: 54,405,119 N703K probably damaging Het
H2afy T A 13: 56,104,909 N87Y probably damaging Het
Hhipl2 G A 1: 183,428,013 V495I probably benign Het
Islr G A 9: 58,158,219 probably benign Het
Lrrc36 T C 8: 105,449,641 Y216H possibly damaging Het
Me2 A G 18: 73,773,134 I528T probably benign Het
Mecr A T 4: 131,857,816 I156F possibly damaging Het
Megf6 A G 4: 154,262,510 probably benign Het
Naip5 A G 13: 100,212,669 S1384P probably damaging Het
Nav2 A G 7: 49,452,465 N337S probably benign Het
Ndn C T 7: 62,348,508 P34L probably benign Het
Neb A T 2: 52,249,281 H3107Q probably benign Het
Nebl A G 2: 17,376,651 V738A possibly damaging Het
Nsd2 G A 5: 33,882,120 R825Q possibly damaging Het
Nsun2 A G 13: 69,627,586 N383S probably damaging Het
Ntrk3 A T 7: 78,247,288 M667K probably damaging Het
Olfr389 A G 11: 73,777,148 Y60H possibly damaging Het
Olfr514 A C 7: 108,825,235 C255G probably benign Het
Olfr745 G A 14: 50,643,108 V276M possibly damaging Het
Olfr791 A T 10: 129,526,619 M131L probably benign Het
Pex6 T C 17: 46,722,632 V633A probably benign Het
Phactr1 C T 13: 42,956,671 T95M probably damaging Het
Pik3r4 A G 9: 105,687,209 D1334G probably damaging Het
Pkhd1l1 A C 15: 44,597,117 I4241L probably benign Het
Ppwd1 T C 13: 104,220,263 E248G probably damaging Het
Prepl A C 17: 85,072,081 M393R probably benign Het
Ptpn6 T C 6: 124,721,185 S532G probably benign Het
Rnase11 G T 14: 51,049,601 H165Q possibly damaging Het
Sf1 A G 19: 6,372,060 N172S possibly damaging Het
Shprh T A 10: 11,157,078 D269E probably benign Het
Slc16a1 T C 3: 104,649,482 I61T possibly damaging Het
Slc38a2 A C 15: 96,692,536 I309S probably damaging Het
Sry C G Y: 2,663,149 Q170H unknown Het
Stk3 A C 15: 35,008,308 probably null Het
Tg C A 15: 66,696,166 C1306* probably null Het
Tnik A G 3: 28,665,740 M1254V probably damaging Het
U2surp T C 9: 95,484,227 E474G possibly damaging Het
Vmn1r224 T A 17: 20,419,325 F55I probably benign Het
Vmn1r32 A G 6: 66,552,955 I279T possibly damaging Het
Zc2hc1a A G 3: 7,516,483 D15G probably benign Het
Zfp827 C A 8: 79,076,346 P516T possibly damaging Het
Zfyve9 A T 4: 108,684,907 probably null Het
Other mutations in Mn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01019:Mn1 APN 5 111421547 missense possibly damaging 0.85
IGL01139:Mn1 APN 5 111421449 missense probably damaging 0.96
IGL01546:Mn1 APN 5 111421248 missense probably damaging 1.00
IGL02252:Mn1 APN 5 111421241 missense probably damaging 0.96
IGL02821:Mn1 APN 5 111421851 missense probably damaging 0.99
IGL03203:Mn1 APN 5 111421403 missense probably benign
Uebermus UTSW 5 111421886 splice site probably null
FR4342:Mn1 UTSW 5 111419706 small insertion probably benign
FR4449:Mn1 UTSW 5 111419710 small insertion probably benign
FR4548:Mn1 UTSW 5 111419698 small insertion probably benign
FR4976:Mn1 UTSW 5 111419702 small insertion probably benign
R0639:Mn1 UTSW 5 111419316 missense probably damaging 1.00
R0676:Mn1 UTSW 5 111421034 missense possibly damaging 0.52
R1537:Mn1 UTSW 5 111454780 missense probably damaging 0.96
R1739:Mn1 UTSW 5 111420014 missense possibly damaging 0.92
R1922:Mn1 UTSW 5 111418746 missense probably damaging 0.99
R2008:Mn1 UTSW 5 111418857 missense probably damaging 1.00
R2104:Mn1 UTSW 5 111454751 missense possibly damaging 0.72
R2519:Mn1 UTSW 5 111418552 missense possibly damaging 0.85
R3980:Mn1 UTSW 5 111421770 missense possibly damaging 0.85
R4008:Mn1 UTSW 5 111420169 missense probably benign
R4564:Mn1 UTSW 5 111420667 missense possibly damaging 0.93
R4647:Mn1 UTSW 5 111420083 missense probably benign
R4779:Mn1 UTSW 5 111419660 missense probably damaging 0.99
R4819:Mn1 UTSW 5 111419937 missense possibly damaging 0.93
R4962:Mn1 UTSW 5 111454786 missense possibly damaging 0.85
R5373:Mn1 UTSW 5 111421886 splice site probably null
R5374:Mn1 UTSW 5 111421886 splice site probably null
R5521:Mn1 UTSW 5 111421769 missense possibly damaging 0.72
R5633:Mn1 UTSW 5 111420326 missense possibly damaging 0.52
R5744:Mn1 UTSW 5 111420536 missense possibly damaging 0.93
R6050:Mn1 UTSW 5 111419397 missense probably damaging 1.00
R6552:Mn1 UTSW 5 111420887 missense possibly damaging 0.93
R7206:Mn1 UTSW 5 111420512 missense possibly damaging 0.85
R7244:Mn1 UTSW 5 111418833 missense possibly damaging 0.78
Z1088:Mn1 UTSW 5 111418280 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- CAAATCAGATGGTAGTTCCCCGCAC -3'
(R):5'- AGGTCGATAGTACTCATGGCGCTC -3'

Sequencing Primer
(F):5'- ACGAAGTGTCATCCAGTTCTG -3'
(R):5'- ATAGTACTCATGGCGCTCTTGAC -3'
Posted On2014-04-24