Mutagenetix > Incidental Mutation

Incidental Mutation 'R1638:Mn1'

173296

Institutional Source

Beutler Lab

Gene Symbol

Mn1

Ensembl Gene

ENSMUSG00000070576

Gene Name

meningioma 1

Synonyms

MMRRC Submission

039674-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1638 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

111417362-111457033 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 111421569 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Histidine at position 1135 (L1135H)

Ref Sequence

ENSEMBL: ENSMUSP00000092034 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000094463]

AlphaFold

D3YWE6

Predicted Effect

probably damaging
Transcript: ENSMUST00000094463
AA Change: L1135H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000092034
Gene: ENSMUSG00000070576
AA Change: L1135H

Domain	Start	End	E-Value	Type
low complexity region	92	124	N/A	INTRINSIC
low complexity region	128	144	N/A	INTRINSIC
low complexity region	201	217	N/A	INTRINSIC
low complexity region	291	303	N/A	INTRINSIC
low complexity region	333	354	N/A	INTRINSIC
coiled coil region	507	548	N/A	INTRINSIC
low complexity region	551	565	N/A	INTRINSIC
low complexity region	569	584	N/A	INTRINSIC
low complexity region	643	657	N/A	INTRINSIC
low complexity region	685	704	N/A	INTRINSIC
low complexity region	708	725	N/A	INTRINSIC
low complexity region	727	738	N/A	INTRINSIC
low complexity region	745	771	N/A	INTRINSIC
low complexity region	780	791	N/A	INTRINSIC
low complexity region	862	892	N/A	INTRINSIC
low complexity region	913	933	N/A	INTRINSIC
low complexity region	957	972	N/A	INTRINSIC
low complexity region	1098	1110	N/A	INTRINSIC
low complexity region	1134	1145	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138784

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000196957

Meta Mutation Damage Score

0.2238

Coding Region Coverage

1x: 99.0%
3x: 97.9%
10x: 94.9%
20x: 87.8%

Validation Efficiency

99% (79/80)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Meningioma 1 (MN1) contains two sets of CAG repeats. It is disrupted by a balanced translocation (4;22) in a meningioma, and its inactivation may contribute to meningioma 32 pathogenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice die shortly after birth due to cleft palate. Development of several bones in the skull was abnormal with completely absent alisphenoid, squamosal, and vomer bones, hypoplastic basisphenoid, pterygoid, and presphenoid bones, and thinfrontal, parietal, and interparietal bones. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	C	T	3: 37,035,812	R4130*	probably null	Het
A2m	C	A	6: 121,654,612	L623M	probably benign	Het
Adamts13	A	G	2: 26,996,583	E938G	possibly damaging	Het
Agfg1	A	T	1: 82,893,538	Q497L	probably damaging	Het
Ahnak	A	G	19: 9,009,449	H2699R	probably benign	Het
Antxrl	G	T	14: 34,070,496		probably null	Het
Apol7c	A	T	15: 77,526,218	V176E	probably damaging	Het
Arid5b	T	C	10: 68,277,947	N87D	possibly damaging	Het
Atp2c1	A	T	9: 105,432,698	I560N	probably damaging	Het
Atp2c2	T	C	8: 119,756,003	F868S	possibly damaging	Het
Blnk	G	C	19: 40,937,678	F326L	probably benign	Het
Ckap2	C	T	8: 22,175,796	V412I	possibly damaging	Het
Clmn	A	G	12: 104,782,022	V422A	probably benign	Het
Ctnnal1	A	G	4: 56,813,856	S638P	probably benign	Het
Cyp2j5	T	C	4: 96,635,815	S327G	probably benign	Het
Dhx38	G	A	8: 109,553,545	T871M	probably damaging	Het
Dmxl1	A	T	18: 49,890,767	K1706*	probably null	Het
Dnah11	A	G	12: 118,015,419	L2648P	possibly damaging	Het
Elf2	G	A	3: 51,308,109	T60I	probably damaging	Het
Fam120b	T	A	17: 15,402,497	C246S	possibly damaging	Het
Fcho2	G	T	13: 98,745,895	T451K	possibly damaging	Het
Fzd9	T	A	5: 135,249,748	I428F	probably damaging	Het
Galnt13	T	A	2: 54,854,655	V122E	probably damaging	Het
Gm21738	T	A	14: 19,418,908	Y8F	probably benign	Het
Gnptab	A	G	10: 88,436,167	I940V	possibly damaging	Het
Gp2	A	G	7: 119,451,498		probably null	Het
Gpr6	A	G	10: 41,070,534	S351P	probably benign	Het
Gprin1	T	C	13: 54,739,876	E195G	possibly damaging	Het
Grm8	A	T	6: 28,125,883	Y81*	probably null	Het
Gtf3c3	A	T	1: 54,405,119	N703K	probably damaging	Het
H2afy	T	A	13: 56,104,909	N87Y	probably damaging	Het
Hhipl2	G	A	1: 183,428,013	V495I	probably benign	Het
Islr	G	A	9: 58,158,219		probably benign	Het
Lrrc36	T	C	8: 105,449,641	Y216H	possibly damaging	Het
Me2	A	G	18: 73,773,134	I528T	probably benign	Het
Mecr	A	T	4: 131,857,816	I156F	possibly damaging	Het
Megf6	A	G	4: 154,262,510		probably benign	Het
Naip5	A	G	13: 100,212,669	S1384P	probably damaging	Het
Nav2	A	G	7: 49,452,465	N337S	probably benign	Het
Ndn	C	T	7: 62,348,508	P34L	probably benign	Het
Neb	A	T	2: 52,249,281	H3107Q	probably benign	Het
Nebl	A	G	2: 17,376,651	V738A	possibly damaging	Het
Nsd2	G	A	5: 33,882,120	R825Q	possibly damaging	Het
Nsun2	A	G	13: 69,627,586	N383S	probably damaging	Het
Ntrk3	A	T	7: 78,247,288	M667K	probably damaging	Het
Olfr389	A	G	11: 73,777,148	Y60H	possibly damaging	Het
Olfr514	A	C	7: 108,825,235	C255G	probably benign	Het
Olfr745	G	A	14: 50,643,108	V276M	possibly damaging	Het
Olfr791	A	T	10: 129,526,619	M131L	probably benign	Het
Pex6	T	C	17: 46,722,632	V633A	probably benign	Het
Phactr1	C	T	13: 42,956,671	T95M	probably damaging	Het
Pik3r4	A	G	9: 105,687,209	D1334G	probably damaging	Het
Pkhd1l1	A	C	15: 44,597,117	I4241L	probably benign	Het
Ppwd1	T	C	13: 104,220,263	E248G	probably damaging	Het
Prepl	A	C	17: 85,072,081	M393R	probably benign	Het
Ptpn6	T	C	6: 124,721,185	S532G	probably benign	Het
Rnase11	G	T	14: 51,049,601	H165Q	possibly damaging	Het
Sf1	A	G	19: 6,372,060	N172S	possibly damaging	Het
Shprh	T	A	10: 11,157,078	D269E	probably benign	Het
Slc16a1	T	C	3: 104,649,482	I61T	possibly damaging	Het
Slc38a2	A	C	15: 96,692,536	I309S	probably damaging	Het
Sry	C	G	Y: 2,663,149	Q170H	unknown	Het
Stk3	A	C	15: 35,008,308		probably null	Het
Tg	C	A	15: 66,696,166	C1306*	probably null	Het
Tnik	A	G	3: 28,665,740	M1254V	probably damaging	Het
U2surp	T	C	9: 95,484,227	E474G	possibly damaging	Het
Vmn1r224	T	A	17: 20,419,325	F55I	probably benign	Het
Vmn1r32	A	G	6: 66,552,955	I279T	possibly damaging	Het
Zc2hc1a	A	G	3: 7,516,483	D15G	probably benign	Het
Zfp827	C	A	8: 79,076,346	P516T	possibly damaging	Het
Zfyve9	A	T	4: 108,684,907		probably null	Het

Other mutations in Mn1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01019:Mn1	APN	5	111421547	missense	possibly damaging	0.85
IGL01139:Mn1	APN	5	111421449	missense	probably damaging	0.96
IGL01546:Mn1	APN	5	111421248	missense	probably damaging	1.00
IGL02252:Mn1	APN	5	111421241	missense	probably damaging	0.96
IGL02821:Mn1	APN	5	111421851	missense	probably damaging	0.99
IGL03203:Mn1	APN	5	111421403	missense	probably benign
Uebermus	UTSW	5	111421886	splice site	probably null
FR4342:Mn1	UTSW	5	111419706	small insertion	probably benign
FR4449:Mn1	UTSW	5	111419710	small insertion	probably benign
FR4548:Mn1	UTSW	5	111419698	small insertion	probably benign
FR4976:Mn1	UTSW	5	111419702	small insertion	probably benign
R0639:Mn1	UTSW	5	111419316	missense	probably damaging	1.00
R0676:Mn1	UTSW	5	111421034	missense	possibly damaging	0.52
R1537:Mn1	UTSW	5	111454780	missense	probably damaging	0.96
R1739:Mn1	UTSW	5	111420014	missense	possibly damaging	0.92
R1922:Mn1	UTSW	5	111418746	missense	probably damaging	0.99
R2008:Mn1	UTSW	5	111418857	missense	probably damaging	1.00
R2104:Mn1	UTSW	5	111454751	missense	possibly damaging	0.72
R2519:Mn1	UTSW	5	111418552	missense	possibly damaging	0.85
R3980:Mn1	UTSW	5	111421770	missense	possibly damaging	0.85
R4008:Mn1	UTSW	5	111420169	missense	probably benign
R4564:Mn1	UTSW	5	111420667	missense	possibly damaging	0.93
R4647:Mn1	UTSW	5	111420083	missense	probably benign
R4779:Mn1	UTSW	5	111419660	missense	probably damaging	0.99
R4819:Mn1	UTSW	5	111419937	missense	possibly damaging	0.93
R4962:Mn1	UTSW	5	111454786	missense	possibly damaging	0.85
R5373:Mn1	UTSW	5	111421886	splice site	probably null
R5374:Mn1	UTSW	5	111421886	splice site	probably null
R5521:Mn1	UTSW	5	111421769	missense	possibly damaging	0.72
R5633:Mn1	UTSW	5	111420326	missense	possibly damaging	0.52
R5744:Mn1	UTSW	5	111420536	missense	possibly damaging	0.93
R6050:Mn1	UTSW	5	111419397	missense	probably damaging	1.00
R6552:Mn1	UTSW	5	111420887	missense	possibly damaging	0.93
R7206:Mn1	UTSW	5	111420512	missense	possibly damaging	0.85
R7244:Mn1	UTSW	5	111418833	missense	possibly damaging	0.78
R8207:Mn1	UTSW	5	111421785	missense	probably damaging	0.99
R8222:Mn1	UTSW	5	111418680	missense	probably damaging	1.00
R8353:Mn1	UTSW	5	111420639	missense	possibly damaging	0.85
R8677:Mn1	UTSW	5	111419019	nonsense	probably null
R8990:Mn1	UTSW	5	111418515	missense	possibly damaging	0.85
R9602:Mn1	UTSW	5	111417583	start gained	probably benign
R9603:Mn1	UTSW	5	111418527	missense	probably damaging	1.00
RF025:Mn1	UTSW	5	111419705	nonsense	probably null
RF027:Mn1	UTSW	5	111419705	small insertion	probably benign
RF028:Mn1	UTSW	5	111419711	small insertion	probably benign
RF032:Mn1	UTSW	5	111419711	small insertion	probably benign
RF040:Mn1	UTSW	5	111419705	small insertion	probably benign
Z1088:Mn1	UTSW	5	111418280	missense	possibly damaging	0.85
Z1176:Mn1	UTSW	5	111420379	missense	probably benign	0.08
Z1176:Mn1	UTSW	5	111454706	missense	possibly damaging	0.93
Z1177:Mn1	UTSW	5	111420068	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAAATCAGATGGTAGTTCCCCGCAC -3'
(R):5'- AGGTCGATAGTACTCATGGCGCTC -3'

Sequencing Primer
(F):5'- ACGAAGTGTCATCCAGTTCTG -3'
(R):5'- ATAGTACTCATGGCGCTCTTGAC -3'

Posted On

2014-04-24