Mutagenetix > Incidental Mutations

Incidental Mutation 'R1638:Ptpn6'

173301

Institutional Source

Beutler Lab

Gene Symbol

Ptpn6

Ensembl Gene

ENSMUSG00000004266

Gene Name

protein tyrosine phosphatase, non-receptor type 6

Synonyms

Hcph, hcp, SHP-1, Ptp1C

MMRRC Submission

039674-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.547) question?

Stock #

R1638 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

124720707-124738714 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 124721185 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Glycine at position 532 (S532G)

Ref Sequence

ENSEMBL: ENSMUSP00000133991 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000004375] [ENSMUST00000004377] [ENSMUST00000112484] [ENSMUST00000171549] [ENSMUST00000174265] [ENSMUST00000174787]

Predicted Effect

probably benign
Transcript: ENSMUST00000004375

SMART Domains

Protein: ENSMUSP00000004375
Gene: ENSMUSG00000004264

Domain	Start	End	E-Value	Type
low complexity region	18	33	N/A	INTRINSIC
PHB	39	201	1.01e-46	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000004377
AA Change: S573G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000004377
Gene: ENSMUSG00000004266
AA Change: S573G

Domain	Start	End	E-Value	Type
SH2	4	87	1.43e-28	SMART
SH2	110	202	1.45e-29	SMART
PTPc	245	519	7.51e-131	SMART
low complexity region	571	581	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000083528

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000083540

Predicted Effect

probably benign
Transcript: ENSMUST00000112484
AA Change: S571G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000108103
Gene: ENSMUSG00000004266
AA Change: S571G

Domain	Start	End	E-Value	Type
SH2	2	85	4.05e-28	SMART
SH2	108	200	1.45e-29	SMART
PTPc	243	517	7.51e-131	SMART
low complexity region	569	579	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129422

Predicted Effect

probably benign
Transcript: ENSMUST00000130279

SMART Domains

Protein: ENSMUSP00000121535
Gene: ENSMUSG00000004264

Domain	Start	End	E-Value	Type
Blast:PHB	2	82	5e-45	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143000

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143765

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145447

Predicted Effect

probably benign
Transcript: ENSMUST00000171549
AA Change: S573G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000129124
Gene: ENSMUSG00000004266
AA Change: S573G

Domain	Start	End	E-Value	Type
SH2	4	87	1.43e-28	SMART
SH2	110	202	1.45e-29	SMART
PTPc	245	519	7.51e-131	SMART
low complexity region	571	581	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000172690

Predicted Effect

unknown
Transcript: ENSMUST00000173315
AA Change: S70G

SMART Domains

Protein: ENSMUSP00000134274
Gene: ENSMUSG00000004266
AA Change: S70G

Domain	Start	End	E-Value	Type
SCOP:d1eeoa_	2	38	1e-3	SMART
PDB:3PS5\|A	2	91	2e-41	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000174265
AA Change: S532G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000133991
Gene: ENSMUSG00000004266
AA Change: S532G

Domain	Start	End	E-Value	Type
Pfam:SH2	1	40	3.5e-6	PFAM
SH2	69	161	1.45e-29	SMART
PTPc	204	478	7.51e-131	SMART
low complexity region	530	540	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000189387

Predicted Effect

probably benign
Transcript: ENSMUST00000174787

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.0%
3x: 97.9%
10x: 94.9%
20x: 87.8%

Validation Efficiency

99% (79/80)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. N-terminal part of this PTP contains two tandem Src homolog (SH2) domains, which act as protein phospho-tyrosine binding domains, and mediate the interaction of this PTP with its substrates. This PTP is expressed primarily in hematopoietic cells, and functions as an important regulator of multiple signaling pathways in hematopoietic cells. This PTP has been shown to interact with, and dephosphorylate a wide spectrum of phospho-proteins involved in hematopoietic cell signaling. Multiple alternatively spliced variants of this gene, which encode distinct isoforms, have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants are immunodeficient and autoimmune and exhibit neutrophilic skin lesions that disrupt hair follicles and give the motheaten appearance. Alleles vary in severity, with death occurring at 6-9 weeks postnatally due to severe pneumonitis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	C	T	3: 37,035,812	R4130*	probably null	Het
A2m	C	A	6: 121,654,612	L623M	probably benign	Het
Adamts13	A	G	2: 26,996,583	E938G	possibly damaging	Het
Agfg1	A	T	1: 82,893,538	Q497L	probably damaging	Het
Ahnak	A	G	19: 9,009,449	H2699R	probably benign	Het
Antxrl	G	T	14: 34,070,496		probably null	Het
Apol7c	A	T	15: 77,526,218	V176E	probably damaging	Het
Arid5b	T	C	10: 68,277,947	N87D	possibly damaging	Het
Atp2c1	A	T	9: 105,432,698	I560N	probably damaging	Het
Atp2c2	T	C	8: 119,756,003	F868S	possibly damaging	Het
Blnk	G	C	19: 40,937,678	F326L	probably benign	Het
Ckap2	C	T	8: 22,175,796	V412I	possibly damaging	Het
Clmn	A	G	12: 104,782,022	V422A	probably benign	Het
Ctnnal1	A	G	4: 56,813,856	S638P	probably benign	Het
Cyp2j5	T	C	4: 96,635,815	S327G	probably benign	Het
Dhx38	G	A	8: 109,553,545	T871M	probably damaging	Het
Dmxl1	A	T	18: 49,890,767	K1706*	probably null	Het
Dnah11	A	G	12: 118,015,419	L2648P	possibly damaging	Het
Elf2	G	A	3: 51,308,109	T60I	probably damaging	Het
Fam120b	T	A	17: 15,402,497	C246S	possibly damaging	Het
Fcho2	G	T	13: 98,745,895	T451K	possibly damaging	Het
Fzd9	T	A	5: 135,249,748	I428F	probably damaging	Het
Galnt13	T	A	2: 54,854,655	V122E	probably damaging	Het
Gm21738	T	A	14: 19,418,908	Y8F	probably benign	Het
Gnptab	A	G	10: 88,436,167	I940V	possibly damaging	Het
Gp2	A	G	7: 119,451,498		probably null	Het
Gpr6	A	G	10: 41,070,534	S351P	probably benign	Het
Gprin1	T	C	13: 54,739,876	E195G	possibly damaging	Het
Grm8	A	T	6: 28,125,883	Y81*	probably null	Het
Gtf3c3	A	T	1: 54,405,119	N703K	probably damaging	Het
H2afy	T	A	13: 56,104,909	N87Y	probably damaging	Het
Hhipl2	G	A	1: 183,428,013	V495I	probably benign	Het
Islr	G	A	9: 58,158,219		probably benign	Het
Lrrc36	T	C	8: 105,449,641	Y216H	possibly damaging	Het
Me2	A	G	18: 73,773,134	I528T	probably benign	Het
Mecr	A	T	4: 131,857,816	I156F	possibly damaging	Het
Megf6	A	G	4: 154,262,510		probably benign	Het
Mn1	T	A	5: 111,421,569	L1135H	probably damaging	Het
Naip5	A	G	13: 100,212,669	S1384P	probably damaging	Het
Nav2	A	G	7: 49,452,465	N337S	probably benign	Het
Ndn	C	T	7: 62,348,508	P34L	probably benign	Het
Neb	A	T	2: 52,249,281	H3107Q	probably benign	Het
Nebl	A	G	2: 17,376,651	V738A	possibly damaging	Het
Nsd2	G	A	5: 33,882,120	R825Q	possibly damaging	Het
Nsun2	A	G	13: 69,627,586	N383S	probably damaging	Het
Ntrk3	A	T	7: 78,247,288	M667K	probably damaging	Het
Olfr389	A	G	11: 73,777,148	Y60H	possibly damaging	Het
Olfr514	A	C	7: 108,825,235	C255G	probably benign	Het
Olfr745	G	A	14: 50,643,108	V276M	possibly damaging	Het
Olfr791	A	T	10: 129,526,619	M131L	probably benign	Het
Pex6	T	C	17: 46,722,632	V633A	probably benign	Het
Phactr1	C	T	13: 42,956,671	T95M	probably damaging	Het
Pik3r4	A	G	9: 105,687,209	D1334G	probably damaging	Het
Pkhd1l1	A	C	15: 44,597,117	I4241L	probably benign	Het
Ppwd1	T	C	13: 104,220,263	E248G	probably damaging	Het
Prepl	A	C	17: 85,072,081	M393R	probably benign	Het
Rnase11	G	T	14: 51,049,601	H165Q	possibly damaging	Het
Sf1	A	G	19: 6,372,060	N172S	possibly damaging	Het
Shprh	T	A	10: 11,157,078	D269E	probably benign	Het
Slc16a1	T	C	3: 104,649,482	I61T	possibly damaging	Het
Slc38a2	A	C	15: 96,692,536	I309S	probably damaging	Het
Sry	C	G	Y: 2,663,149	Q170H	unknown	Het
Stk3	A	C	15: 35,008,308		probably null	Het
Tg	C	A	15: 66,696,166	C1306*	probably null	Het
Tnik	A	G	3: 28,665,740	M1254V	probably damaging	Het
U2surp	T	C	9: 95,484,227	E474G	possibly damaging	Het
Vmn1r224	T	A	17: 20,419,325	F55I	probably benign	Het
Vmn1r32	A	G	6: 66,552,955	I279T	possibly damaging	Het
Zc2hc1a	A	G	3: 7,516,483	D15G	probably benign	Het
Zfp827	C	A	8: 79,076,346	P516T	possibly damaging	Het
Zfyve9	A	T	4: 108,684,907		probably null	Het

Other mutations in Ptpn6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00710:Ptpn6	APN	6	124732356	splice site	probably null
IGL01490:Ptpn6	APN	6	124728344	missense	probably damaging	1.00
IGL01865:Ptpn6	APN	6	124732465	missense	probably damaging	1.00
IGL02017:Ptpn6	APN	6	124732486	missense	probably damaging	0.98
IGL02272:Ptpn6	APN	6	124721208	missense	probably damaging	0.99
IGL02276:Ptpn6	APN	6	124728865	missense	probably null	1.00
IGL02556:Ptpn6	APN	6	124728660	missense	probably benign	0.00
candle	UTSW	6	124728419	missense	probably damaging	1.00
caterpillar	UTSW	6	124724984	missense	probably benign
farfalla_notturna	UTSW	6	124732435	missense	probably damaging	1.00
Flutterby	UTSW	6	124721858	missense	possibly damaging	0.89
Lepidopteran	UTSW	6	124728172	missense	probably damaging	1.00
Malachite	UTSW	6	124728651	missense	possibly damaging	0.84
Naphthalene	UTSW	6	124721789	missense	probably benign	0.42
R5878_ptpn6_652	UTSW	6	124728785	missense	probably damaging	1.00
spin	UTSW	6	124728559	missense	probably damaging	1.00
spin2	UTSW	6	124732369	missense	probably damaging	1.00
Vermeil	UTSW	6	124732950	missense	probably benign	0.10
R0183:Ptpn6	UTSW	6	124728951	missense	probably damaging	1.00
R0254:Ptpn6	UTSW	6	124728150	missense	probably damaging	1.00
R0636:Ptpn6	UTSW	6	124725279	missense	probably benign
R0835:Ptpn6	UTSW	6	124727536	critical splice acceptor site	probably null
R1383:Ptpn6	UTSW	6	124721893	missense	probably damaging	1.00
R1900:Ptpn6	UTSW	6	124728933	missense	probably benign	0.15
R2047:Ptpn6	UTSW	6	124721789	missense	probably benign	0.42
R2143:Ptpn6	UTSW	6	124724984	missense	probably benign	0.01
R3907:Ptpn6	UTSW	6	124725276	missense	possibly damaging	0.86
R4082:Ptpn6	UTSW	6	124728419	missense	probably damaging	1.00
R4382:Ptpn6	UTSW	6	124727398	missense	possibly damaging	0.86
R5319:Ptpn6	UTSW	6	124732950	missense	probably benign	0.10
R5807:Ptpn6	UTSW	6	124724984	missense	probably benign
R5878:Ptpn6	UTSW	6	124728785	missense	probably damaging	1.00
R6056:Ptpn6	UTSW	6	124732435	missense	probably damaging	1.00
R6374:Ptpn6	UTSW	6	124732569	splice site	probably null
R7238:Ptpn6	UTSW	6	124721858	missense	possibly damaging	0.89
R7381:Ptpn6	UTSW	6	124728172	missense	probably damaging	1.00
R7935:Ptpn6	UTSW	6	124732462	missense	possibly damaging	0.93
R8297:Ptpn6	UTSW	6	124728651	missense	possibly damaging	0.84
Z1176:Ptpn6	UTSW	6	124725076	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TGCACGCACGTCTGAACTGAAG -3'
(R):5'- GCCCTAACTGTCCTTTTCTGGAGTG -3'

Sequencing Primer
(F):5'- CACGTCTGAACTGAAGTTGGG -3'
(R):5'- ACCCTGGTTCAAGGTCAAG -3'

Posted On

2014-04-24