Mutagenetix > Incidental Mutations

Incidental Mutation 'R1638:Ntrk3'

173304

Institutional Source

Beutler Lab

Gene Symbol

Ntrk3

Ensembl Gene

ENSMUSG00000059146

Gene Name

neurotrophic tyrosine kinase, receptor, type 3

Synonyms

TrkC

MMRRC Submission

039674-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1638 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

78175959-78738012 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 78247288 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 667 (M667K)

Ref Sequence

ENSEMBL: ENSMUSP00000141599 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039431] [ENSMUST00000193002] [ENSMUST00000195262]

AlphaFold

Q6VNS1

Predicted Effect

probably damaging
Transcript: ENSMUST00000039431
AA Change: M667K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000037909
Gene: ENSMUSG00000059146
AA Change: M667K

Domain	Start	End	E-Value	Type
LRRNT	31	63	2.46e-4	SMART
LRRCT	160	208	3.58e-12	SMART
IG	216	302	1.24e-8	SMART
Pfam:I-set	308	392	2.4e-8	PFAM
transmembrane domain	430	452	N/A	INTRINSIC
TyrKc	538	810	1.49e-145	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000193002
AA Change: M667K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000141534
Gene: ENSMUSG00000059146
AA Change: M667K

Domain	Start	End	E-Value	Type
LRRNT	31	63	2.46e-4	SMART
LRRCT	160	208	3.58e-12	SMART
IG	216	302	1.24e-8	SMART
Pfam:I-set	308	392	2.4e-8	PFAM
Pfam:Ig_2	312	392	6.9e-4	PFAM
transmembrane domain	430	452	N/A	INTRINSIC
TyrKc	538	824	4.29e-137	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000195262
AA Change: M667K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000141599
Gene: ENSMUSG00000059146
AA Change: M667K

Domain	Start	End	E-Value	Type
LRRNT	31	63	1.2e-6	SMART
LRRCT	160	208	1.8e-14	SMART
IG	216	302	5.1e-11	SMART
Pfam:I-set	308	392	4.7e-7	PFAM
Pfam:Ig_2	312	392	1.3e-2	PFAM
transmembrane domain	430	452	N/A	INTRINSIC
TyrKc	538	849	9.7e-132	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000205868

Meta Mutation Damage Score

0.9179

Coding Region Coverage

1x: 99.0%
3x: 97.9%
10x: 94.9%
20x: 87.8%

Validation Efficiency

99% (79/80)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neurotrophic tyrosine receptor kinase (NTRK) family. This kinase is a membrane-bound receptor that, upon neurotrophin binding, phosphorylates itself and members of the MAPK pathway. Signalling through this kinase leads to cell differentiation and may play a role in the development of proprioceptive neurons that sense body position. Mutations in this gene have been associated with medulloblastomas, secretory breast carcinomas and other cancers. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2011]
PHENOTYPE: Homozygotes for targeted mutations show a range of phenotypes including postnatal death at 2-21 days, cardiac defects, reduced numbers of dorsal root ganglia neurons and germ cells, abnormal motor coordination and posture and abnormal sensory innervation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	C	T	3: 37,035,812	R4130*	probably null	Het
A2m	C	A	6: 121,654,612	L623M	probably benign	Het
Adamts13	A	G	2: 26,996,583	E938G	possibly damaging	Het
Agfg1	A	T	1: 82,893,538	Q497L	probably damaging	Het
Ahnak	A	G	19: 9,009,449	H2699R	probably benign	Het
Antxrl	G	T	14: 34,070,496		probably null	Het
Apol7c	A	T	15: 77,526,218	V176E	probably damaging	Het
Arid5b	T	C	10: 68,277,947	N87D	possibly damaging	Het
Atp2c1	A	T	9: 105,432,698	I560N	probably damaging	Het
Atp2c2	T	C	8: 119,756,003	F868S	possibly damaging	Het
Blnk	G	C	19: 40,937,678	F326L	probably benign	Het
Ckap2	C	T	8: 22,175,796	V412I	possibly damaging	Het
Clmn	A	G	12: 104,782,022	V422A	probably benign	Het
Ctnnal1	A	G	4: 56,813,856	S638P	probably benign	Het
Cyp2j5	T	C	4: 96,635,815	S327G	probably benign	Het
Dhx38	G	A	8: 109,553,545	T871M	probably damaging	Het
Dmxl1	A	T	18: 49,890,767	K1706*	probably null	Het
Dnah11	A	G	12: 118,015,419	L2648P	possibly damaging	Het
Elf2	G	A	3: 51,308,109	T60I	probably damaging	Het
Fam120b	T	A	17: 15,402,497	C246S	possibly damaging	Het
Fcho2	G	T	13: 98,745,895	T451K	possibly damaging	Het
Fzd9	T	A	5: 135,249,748	I428F	probably damaging	Het
Galnt13	T	A	2: 54,854,655	V122E	probably damaging	Het
Gm21738	T	A	14: 19,418,908	Y8F	probably benign	Het
Gnptab	A	G	10: 88,436,167	I940V	possibly damaging	Het
Gp2	A	G	7: 119,451,498		probably null	Het
Gpr6	A	G	10: 41,070,534	S351P	probably benign	Het
Gprin1	T	C	13: 54,739,876	E195G	possibly damaging	Het
Grm8	A	T	6: 28,125,883	Y81*	probably null	Het
Gtf3c3	A	T	1: 54,405,119	N703K	probably damaging	Het
H2afy	T	A	13: 56,104,909	N87Y	probably damaging	Het
Hhipl2	G	A	1: 183,428,013	V495I	probably benign	Het
Islr	G	A	9: 58,158,219		probably benign	Het
Lrrc36	T	C	8: 105,449,641	Y216H	possibly damaging	Het
Me2	A	G	18: 73,773,134	I528T	probably benign	Het
Mecr	A	T	4: 131,857,816	I156F	possibly damaging	Het
Megf6	A	G	4: 154,262,510		probably benign	Het
Mn1	T	A	5: 111,421,569	L1135H	probably damaging	Het
Naip5	A	G	13: 100,212,669	S1384P	probably damaging	Het
Nav2	A	G	7: 49,452,465	N337S	probably benign	Het
Ndn	C	T	7: 62,348,508	P34L	probably benign	Het
Neb	A	T	2: 52,249,281	H3107Q	probably benign	Het
Nebl	A	G	2: 17,376,651	V738A	possibly damaging	Het
Nsd2	G	A	5: 33,882,120	R825Q	possibly damaging	Het
Nsun2	A	G	13: 69,627,586	N383S	probably damaging	Het
Olfr389	A	G	11: 73,777,148	Y60H	possibly damaging	Het
Olfr514	A	C	7: 108,825,235	C255G	probably benign	Het
Olfr745	G	A	14: 50,643,108	V276M	possibly damaging	Het
Olfr791	A	T	10: 129,526,619	M131L	probably benign	Het
Pex6	T	C	17: 46,722,632	V633A	probably benign	Het
Phactr1	C	T	13: 42,956,671	T95M	probably damaging	Het
Pik3r4	A	G	9: 105,687,209	D1334G	probably damaging	Het
Pkhd1l1	A	C	15: 44,597,117	I4241L	probably benign	Het
Ppwd1	T	C	13: 104,220,263	E248G	probably damaging	Het
Prepl	A	C	17: 85,072,081	M393R	probably benign	Het
Ptpn6	T	C	6: 124,721,185	S532G	probably benign	Het
Rnase11	G	T	14: 51,049,601	H165Q	possibly damaging	Het
Sf1	A	G	19: 6,372,060	N172S	possibly damaging	Het
Shprh	T	A	10: 11,157,078	D269E	probably benign	Het
Slc16a1	T	C	3: 104,649,482	I61T	possibly damaging	Het
Slc38a2	A	C	15: 96,692,536	I309S	probably damaging	Het
Sry	C	G	Y: 2,663,149	Q170H	unknown	Het
Stk3	A	C	15: 35,008,308		probably null	Het
Tg	C	A	15: 66,696,166	C1306*	probably null	Het
Tnik	A	G	3: 28,665,740	M1254V	probably damaging	Het
U2surp	T	C	9: 95,484,227	E474G	possibly damaging	Het
Vmn1r224	T	A	17: 20,419,325	F55I	probably benign	Het
Vmn1r32	A	G	6: 66,552,955	I279T	possibly damaging	Het
Zc2hc1a	A	G	3: 7,516,483	D15G	probably benign	Het
Zfp827	C	A	8: 79,076,346	P516T	possibly damaging	Het
Zfyve9	A	T	4: 108,684,907		probably null	Het

Other mutations in Ntrk3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00424:Ntrk3	APN	7	78250873	missense	probably benign	0.03
IGL00862:Ntrk3	APN	7	78247177	missense	probably damaging	1.00
IGL00972:Ntrk3	APN	7	78247322	missense	possibly damaging	0.95
IGL00976:Ntrk3	APN	7	78450953	missense	probably benign	0.02
IGL02172:Ntrk3	APN	7	78460272	splice site	probably benign
IGL02175:Ntrk3	APN	7	78247228	missense	probably damaging	1.00
IGL02213:Ntrk3	APN	7	78462931	missense	probably benign	0.17
IGL02363:Ntrk3	APN	7	78453337	missense	probably benign	0.24
IGL02527:Ntrk3	APN	7	78451949	missense	probably benign
IGL02673:Ntrk3	APN	7	78250764	missense	probably damaging	1.00
IGL02755:Ntrk3	APN	7	78460439	missense	probably benign
IGL02998:Ntrk3	APN	7	78577657	missense	probably damaging	0.98
IGL03235:Ntrk3	APN	7	78192592	missense	probably damaging	1.00
R1465:Ntrk3	UTSW	7	78356014	splice site	probably benign
R1505:Ntrk3	UTSW	7	78460524	missense	probably damaging	0.99
R1641:Ntrk3	UTSW	7	78356074	missense	probably damaging	1.00
R1775:Ntrk3	UTSW	7	78356041	missense	possibly damaging	0.60
R1786:Ntrk3	UTSW	7	78477935	splice site	probably benign
R1827:Ntrk3	UTSW	7	78247301	missense	probably damaging	1.00
R1868:Ntrk3	UTSW	7	78192604	missense	possibly damaging	0.90
R1873:Ntrk3	UTSW	7	78462839	missense	probably benign
R1929:Ntrk3	UTSW	7	78516723	splice site	probably null
R1941:Ntrk3	UTSW	7	78247262	missense	probably damaging	1.00
R2132:Ntrk3	UTSW	7	78477935	splice site	probably benign
R2214:Ntrk3	UTSW	7	78516772	missense	probably damaging	1.00
R2221:Ntrk3	UTSW	7	78198852	missense	probably damaging	1.00
R2223:Ntrk3	UTSW	7	78198852	missense	probably damaging	1.00
R2271:Ntrk3	UTSW	7	78516723	splice site	probably null
R2441:Ntrk3	UTSW	7	78302662	missense	probably damaging	1.00
R3108:Ntrk3	UTSW	7	78460515	missense	probably benign	0.01
R3109:Ntrk3	UTSW	7	78460515	missense	probably benign	0.01
R3959:Ntrk3	UTSW	7	78198842	missense	probably damaging	1.00
R4016:Ntrk3	UTSW	7	78462947	splice site	probably benign
R4028:Ntrk3	UTSW	7	78192710	missense	probably damaging	1.00
R4067:Ntrk3	UTSW	7	78517437	missense	probably damaging	1.00
R4398:Ntrk3	UTSW	7	78250769	nonsense	probably null
R4664:Ntrk3	UTSW	7	78461099	missense	probably damaging	0.99
R5045:Ntrk3	UTSW	7	78460424	missense	probably benign	0.13
R5081:Ntrk3	UTSW	7	78577774	missense	probably damaging	0.99
R5151:Ntrk3	UTSW	7	78247300	missense	probably damaging	1.00
R5249:Ntrk3	UTSW	7	78461166	missense	possibly damaging	0.87
R5294:Ntrk3	UTSW	7	78517506	splice site	probably null
R5594:Ntrk3	UTSW	7	78451899	missense	probably benign	0.10
R5923:Ntrk3	UTSW	7	78451928	missense	possibly damaging	0.61
R6878:Ntrk3	UTSW	7	78304372	missense	probably benign	0.00
R7083:Ntrk3	UTSW	7	78250839	missense	probably damaging	1.00
R7178:Ntrk3	UTSW	7	78356147	missense	possibly damaging	0.86
R7487:Ntrk3	UTSW	7	78250713	missense	probably damaging	1.00
R7607:Ntrk3	UTSW	7	78250873	missense	probably benign	0.03
R7800:Ntrk3	UTSW	7	78302740	missense	probably benign	0.09
R7961:Ntrk3	UTSW	7	78453328	missense	probably benign
R7976:Ntrk3	UTSW	7	78356206	missense	probably damaging	0.97
R8009:Ntrk3	UTSW	7	78453328	missense	probably benign
R8032:Ntrk3	UTSW	7	78356059	missense	probably damaging	1.00
R8104:Ntrk3	UTSW	7	78577702	missense	probably damaging	0.99
R8230:Ntrk3	UTSW	7	78250770	missense	probably damaging	1.00
R8254:Ntrk3	UTSW	7	78192578	missense	probably damaging	1.00
R8412:Ntrk3	UTSW	7	78356149	missense	probably benign	0.02
R8465:Ntrk3	UTSW	7	78462883	missense	probably damaging	0.99
R8841:Ntrk3	UTSW	7	78356093	missense	probably damaging	0.99
R9187:Ntrk3	UTSW	7	78247218	missense	possibly damaging	0.93

Predicted Primers

PCR Primer
(F):5'- GTAAGCAAGGCACTAGCTCAGCAAC -3'
(R):5'- CTTTCTGAAGGATGTTCCAGAGCCC -3'

Sequencing Primer
(F):5'- AGCTCAGCAACTTAGTCCTG -3'
(R):5'- ATGATCCTCGTGGATGGACA -3'

Posted On

2014-04-24