Incidental Mutation 'R1638:Atp2c2'
ID 173311
Institutional Source Beutler Lab
Gene Symbol Atp2c2
Ensembl Gene ENSMUSG00000034112
Gene Name ATPase, Ca++ transporting, type 2C, member 2
Synonyms 1810010G06Rik
MMRRC Submission 039674-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1638 (G1)
Quality Score 220
Status Validated
Chromosome 8
Chromosomal Location 120426748-120484456 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 120482742 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 868 (F868S)
Ref Sequence ENSEMBL: ENSMUSP00000092794 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049156] [ENSMUST00000095171]
AlphaFold A7L9Z8
Predicted Effect probably benign
Transcript: ENSMUST00000049156
SMART Domains Protein: ENSMUSP00000044430
Gene: ENSMUSG00000034105

DomainStartEndE-ValueType
TLDc 241 410 4.36e-69 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000095171
AA Change: F868S

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000092794
Gene: ENSMUSG00000034112
AA Change: F868S

DomainStartEndE-ValueType
Cation_ATPase_N 54 128 1.27e-12 SMART
Pfam:E1-E2_ATPase 133 366 1.7e-62 PFAM
Pfam:Hydrolase 371 684 5.3e-18 PFAM
Pfam:HAD 374 681 7.4e-11 PFAM
Pfam:Cation_ATPase 437 521 1.1e-17 PFAM
Pfam:Cation_ATPase_C 754 927 1.1e-47 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 94.9%
  • 20x: 87.8%
Validation Efficiency 99% (79/80)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m C A 6: 121,631,571 (GRCm39) L623M probably benign Het
Adamts13 A G 2: 26,886,595 (GRCm39) E938G possibly damaging Het
Agfg1 A T 1: 82,871,259 (GRCm39) Q497L probably damaging Het
Ahnak A G 19: 8,986,813 (GRCm39) H2699R probably benign Het
Antxrl G T 14: 33,792,453 (GRCm39) probably null Het
Apol7c A T 15: 77,410,418 (GRCm39) V176E probably damaging Het
Arid5b T C 10: 68,113,777 (GRCm39) N87D possibly damaging Het
Atp2c1 A T 9: 105,309,897 (GRCm39) I560N probably damaging Het
Blnk G C 19: 40,926,122 (GRCm39) F326L probably benign Het
Bltp1 C T 3: 37,089,961 (GRCm39) R4130* probably null Het
Ckap2 C T 8: 22,665,812 (GRCm39) V412I possibly damaging Het
Clmn A G 12: 104,748,281 (GRCm39) V422A probably benign Het
Ctnnal1 A G 4: 56,813,856 (GRCm39) S638P probably benign Het
Cyp2j5 T C 4: 96,524,052 (GRCm39) S327G probably benign Het
Dhx38 G A 8: 110,280,177 (GRCm39) T871M probably damaging Het
Dmxl1 A T 18: 50,023,834 (GRCm39) K1706* probably null Het
Dnah11 A G 12: 117,979,154 (GRCm39) L2648P possibly damaging Het
Elf2 G A 3: 51,215,530 (GRCm39) T60I probably damaging Het
Fam120b T A 17: 15,622,759 (GRCm39) C246S possibly damaging Het
Fcho2 G T 13: 98,882,403 (GRCm39) T451K possibly damaging Het
Fzd9 T A 5: 135,278,602 (GRCm39) I428F probably damaging Het
Galnt13 T A 2: 54,744,667 (GRCm39) V122E probably damaging Het
Gm21738 T A 14: 19,418,908 (GRCm38) Y8F probably benign Het
Gnptab A G 10: 88,272,029 (GRCm39) I940V possibly damaging Het
Gp2 A G 7: 119,050,721 (GRCm39) probably null Het
Gpr6 A G 10: 40,946,530 (GRCm39) S351P probably benign Het
Gprin1 T C 13: 54,887,689 (GRCm39) E195G possibly damaging Het
Grm8 A T 6: 28,125,882 (GRCm39) Y81* probably null Het
Gtf3c3 A T 1: 54,444,278 (GRCm39) N703K probably damaging Het
Hhipl2 G A 1: 183,208,921 (GRCm39) V495I probably benign Het
Islr G A 9: 58,065,502 (GRCm39) probably benign Het
Lrrc36 T C 8: 106,176,273 (GRCm39) Y216H possibly damaging Het
Macroh2a1 T A 13: 56,252,722 (GRCm39) N87Y probably damaging Het
Me2 A G 18: 73,906,205 (GRCm39) I528T probably benign Het
Mecr A T 4: 131,585,127 (GRCm39) I156F possibly damaging Het
Megf6 A G 4: 154,346,967 (GRCm39) probably benign Het
Mn1 T A 5: 111,569,435 (GRCm39) L1135H probably damaging Het
Naip5 A G 13: 100,349,177 (GRCm39) S1384P probably damaging Het
Nav2 A G 7: 49,102,213 (GRCm39) N337S probably benign Het
Ndn C T 7: 61,998,256 (GRCm39) P34L probably benign Het
Neb A T 2: 52,139,293 (GRCm39) H3107Q probably benign Het
Nebl A G 2: 17,381,462 (GRCm39) V738A possibly damaging Het
Nsd2 G A 5: 34,039,464 (GRCm39) R825Q possibly damaging Het
Nsun2 A G 13: 69,775,705 (GRCm39) N383S probably damaging Het
Ntrk3 A T 7: 77,897,036 (GRCm39) M667K probably damaging Het
Or10a48 A C 7: 108,424,442 (GRCm39) C255G probably benign Het
Or11h6 G A 14: 50,880,565 (GRCm39) V276M possibly damaging Het
Or1e29 A G 11: 73,667,974 (GRCm39) Y60H possibly damaging Het
Or6c2 A T 10: 129,362,488 (GRCm39) M131L probably benign Het
Pex6 T C 17: 47,033,558 (GRCm39) V633A probably benign Het
Phactr1 C T 13: 43,110,147 (GRCm39) T95M probably damaging Het
Pik3r4 A G 9: 105,564,408 (GRCm39) D1334G probably damaging Het
Pkhd1l1 A C 15: 44,460,513 (GRCm39) I4241L probably benign Het
Ppwd1 T C 13: 104,356,771 (GRCm39) E248G probably damaging Het
Prepl A C 17: 85,379,509 (GRCm39) M393R probably benign Het
Ptpn6 T C 6: 124,698,148 (GRCm39) S532G probably benign Het
Rnase11 G T 14: 51,287,058 (GRCm39) H165Q possibly damaging Het
Sf1 A G 19: 6,422,090 (GRCm39) N172S possibly damaging Het
Shprh T A 10: 11,032,822 (GRCm39) D269E probably benign Het
Slc16a1 T C 3: 104,556,798 (GRCm39) I61T possibly damaging Het
Slc38a2 A C 15: 96,590,417 (GRCm39) I309S probably damaging Het
Sry C G Y: 2,663,149 (GRCm39) Q170H unknown Het
Stk3 A C 15: 35,008,454 (GRCm39) probably null Het
Tg C A 15: 66,568,015 (GRCm39) C1306* probably null Het
Tnik A G 3: 28,719,889 (GRCm39) M1254V probably damaging Het
U2surp T C 9: 95,366,280 (GRCm39) E474G possibly damaging Het
Vmn1r224 T A 17: 20,639,587 (GRCm39) F55I probably benign Het
Vmn1r32 A G 6: 66,529,939 (GRCm39) I279T possibly damaging Het
Zc2hc1a A G 3: 7,581,543 (GRCm39) D15G probably benign Het
Zfp827 C A 8: 79,802,975 (GRCm39) P516T possibly damaging Het
Zfyve9 A T 4: 108,542,104 (GRCm39) probably null Het
Other mutations in Atp2c2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00966:Atp2c2 APN 8 120,472,329 (GRCm39) missense probably benign
IGL01624:Atp2c2 APN 8 120,484,189 (GRCm39) missense probably benign 0.00
IGL02133:Atp2c2 APN 8 120,481,074 (GRCm39) missense probably benign 0.00
IGL02221:Atp2c2 APN 8 120,471,073 (GRCm39) missense probably damaging 1.00
IGL02606:Atp2c2 APN 8 120,457,013 (GRCm39) missense probably benign
IGL02657:Atp2c2 APN 8 120,479,771 (GRCm39) missense probably damaging 1.00
IGL02839:Atp2c2 APN 8 120,475,859 (GRCm39) missense possibly damaging 0.85
IGL03122:Atp2c2 APN 8 120,469,414 (GRCm39) missense possibly damaging 0.77
R0031:Atp2c2 UTSW 8 120,475,801 (GRCm39) missense probably benign 0.15
R0372:Atp2c2 UTSW 8 120,484,180 (GRCm39) missense probably benign
R0502:Atp2c2 UTSW 8 120,461,316 (GRCm39) missense probably null 0.99
R0503:Atp2c2 UTSW 8 120,461,316 (GRCm39) missense probably null 0.99
R0584:Atp2c2 UTSW 8 120,465,157 (GRCm39) missense probably benign 0.01
R1225:Atp2c2 UTSW 8 120,461,984 (GRCm39) missense probably damaging 1.00
R1580:Atp2c2 UTSW 8 120,479,726 (GRCm39) missense probably benign 0.00
R1620:Atp2c2 UTSW 8 120,475,865 (GRCm39) missense probably benign
R1745:Atp2c2 UTSW 8 120,451,833 (GRCm39) missense probably benign 0.02
R1746:Atp2c2 UTSW 8 120,461,182 (GRCm39) unclassified probably benign
R1907:Atp2c2 UTSW 8 120,476,615 (GRCm39) splice site probably benign
R2104:Atp2c2 UTSW 8 120,476,584 (GRCm39) missense probably benign
R2151:Atp2c2 UTSW 8 120,482,841 (GRCm39) missense probably benign
R2152:Atp2c2 UTSW 8 120,482,841 (GRCm39) missense probably benign
R2154:Atp2c2 UTSW 8 120,482,841 (GRCm39) missense probably benign
R2207:Atp2c2 UTSW 8 120,475,048 (GRCm39) missense probably damaging 1.00
R3874:Atp2c2 UTSW 8 120,462,035 (GRCm39) missense possibly damaging 0.74
R3912:Atp2c2 UTSW 8 120,448,015 (GRCm39) missense probably damaging 1.00
R4093:Atp2c2 UTSW 8 120,476,610 (GRCm39) critical splice donor site probably null
R4782:Atp2c2 UTSW 8 120,475,891 (GRCm39) missense probably damaging 0.97
R4801:Atp2c2 UTSW 8 120,474,426 (GRCm39) missense probably damaging 1.00
R4973:Atp2c2 UTSW 8 120,481,002 (GRCm39) missense probably benign 0.00
R5485:Atp2c2 UTSW 8 120,479,801 (GRCm39) critical splice donor site probably null
R5978:Atp2c2 UTSW 8 120,476,614 (GRCm39) splice site probably null
R6377:Atp2c2 UTSW 8 120,453,093 (GRCm39) missense probably benign 0.10
R6613:Atp2c2 UTSW 8 120,482,760 (GRCm39) missense probably damaging 0.99
R6765:Atp2c2 UTSW 8 120,479,756 (GRCm39) missense probably damaging 1.00
R6836:Atp2c2 UTSW 8 120,461,154 (GRCm39) missense probably damaging 1.00
R6963:Atp2c2 UTSW 8 120,457,006 (GRCm39) nonsense probably null
R7220:Atp2c2 UTSW 8 120,472,300 (GRCm39) missense probably benign 0.00
R7238:Atp2c2 UTSW 8 120,469,160 (GRCm39) missense possibly damaging 0.73
R7373:Atp2c2 UTSW 8 120,456,991 (GRCm39) missense probably benign 0.02
R7438:Atp2c2 UTSW 8 120,474,936 (GRCm39) missense probably damaging 1.00
R7573:Atp2c2 UTSW 8 120,478,008 (GRCm39) missense probably damaging 1.00
R7677:Atp2c2 UTSW 8 120,474,915 (GRCm39) missense probably benign 0.00
R7737:Atp2c2 UTSW 8 120,469,134 (GRCm39) missense probably damaging 1.00
R7912:Atp2c2 UTSW 8 120,456,917 (GRCm39) missense possibly damaging 0.81
R8821:Atp2c2 UTSW 8 120,476,033 (GRCm39) splice site probably null
R8831:Atp2c2 UTSW 8 120,476,033 (GRCm39) splice site probably null
R9200:Atp2c2 UTSW 8 120,474,999 (GRCm39) nonsense probably null
R9211:Atp2c2 UTSW 8 120,446,032 (GRCm39) missense probably benign
R9246:Atp2c2 UTSW 8 120,456,989 (GRCm39) missense probably damaging 1.00
R9285:Atp2c2 UTSW 8 120,465,141 (GRCm39) missense probably benign 0.00
RF004:Atp2c2 UTSW 8 120,479,561 (GRCm39) missense probably damaging 1.00
RF012:Atp2c2 UTSW 8 120,472,253 (GRCm39) missense possibly damaging 0.91
Z1177:Atp2c2 UTSW 8 120,461,124 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGGTACAGCTTTCATTCCATCAGGG -3'
(R):5'- AGAACAGAAGCCTGTGGACTAGCC -3'

Sequencing Primer
(F):5'- GGGCTCCAACCCACCTC -3'
(R):5'- ACTAGCCTGCCGCTCAAG -3'
Posted On 2014-04-24