Incidental Mutation 'R1638:Atp2c2'
ID 173311
Institutional Source Beutler Lab
Gene Symbol Atp2c2
Ensembl Gene ENSMUSG00000034112
Gene Name ATPase, Ca++ transporting, type 2C, member 2
Synonyms
MMRRC Submission 039674-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1638 (G1)
Quality Score 220
Status Validated
Chromosome 8
Chromosomal Location 119700009-119757717 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 119756003 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 868 (F868S)
Ref Sequence ENSEMBL: ENSMUSP00000092794 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049156] [ENSMUST00000095171]
AlphaFold A7L9Z8
Predicted Effect probably benign
Transcript: ENSMUST00000049156
SMART Domains Protein: ENSMUSP00000044430
Gene: ENSMUSG00000034105

DomainStartEndE-ValueType
TLDc 241 410 4.36e-69 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000095171
AA Change: F868S

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000092794
Gene: ENSMUSG00000034112
AA Change: F868S

DomainStartEndE-ValueType
Cation_ATPase_N 54 128 1.27e-12 SMART
Pfam:E1-E2_ATPase 133 366 1.7e-62 PFAM
Pfam:Hydrolase 371 684 5.3e-18 PFAM
Pfam:HAD 374 681 7.4e-11 PFAM
Pfam:Cation_ATPase 437 521 1.1e-17 PFAM
Pfam:Cation_ATPase_C 754 927 1.1e-47 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 94.9%
  • 20x: 87.8%
Validation Efficiency 99% (79/80)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik C T 3: 37,035,812 R4130* probably null Het
A2m C A 6: 121,654,612 L623M probably benign Het
Adamts13 A G 2: 26,996,583 E938G possibly damaging Het
Agfg1 A T 1: 82,893,538 Q497L probably damaging Het
Ahnak A G 19: 9,009,449 H2699R probably benign Het
Antxrl G T 14: 34,070,496 probably null Het
Apol7c A T 15: 77,526,218 V176E probably damaging Het
Arid5b T C 10: 68,277,947 N87D possibly damaging Het
Atp2c1 A T 9: 105,432,698 I560N probably damaging Het
Blnk G C 19: 40,937,678 F326L probably benign Het
Ckap2 C T 8: 22,175,796 V412I possibly damaging Het
Clmn A G 12: 104,782,022 V422A probably benign Het
Ctnnal1 A G 4: 56,813,856 S638P probably benign Het
Cyp2j5 T C 4: 96,635,815 S327G probably benign Het
Dhx38 G A 8: 109,553,545 T871M probably damaging Het
Dmxl1 A T 18: 49,890,767 K1706* probably null Het
Dnah11 A G 12: 118,015,419 L2648P possibly damaging Het
Elf2 G A 3: 51,308,109 T60I probably damaging Het
Fam120b T A 17: 15,402,497 C246S possibly damaging Het
Fcho2 G T 13: 98,745,895 T451K possibly damaging Het
Fzd9 T A 5: 135,249,748 I428F probably damaging Het
Galnt13 T A 2: 54,854,655 V122E probably damaging Het
Gm21738 T A 14: 19,418,908 Y8F probably benign Het
Gnptab A G 10: 88,436,167 I940V possibly damaging Het
Gp2 A G 7: 119,451,498 probably null Het
Gpr6 A G 10: 41,070,534 S351P probably benign Het
Gprin1 T C 13: 54,739,876 E195G possibly damaging Het
Grm8 A T 6: 28,125,883 Y81* probably null Het
Gtf3c3 A T 1: 54,405,119 N703K probably damaging Het
H2afy T A 13: 56,104,909 N87Y probably damaging Het
Hhipl2 G A 1: 183,428,013 V495I probably benign Het
Islr G A 9: 58,158,219 probably benign Het
Lrrc36 T C 8: 105,449,641 Y216H possibly damaging Het
Me2 A G 18: 73,773,134 I528T probably benign Het
Mecr A T 4: 131,857,816 I156F possibly damaging Het
Megf6 A G 4: 154,262,510 probably benign Het
Mn1 T A 5: 111,421,569 L1135H probably damaging Het
Naip5 A G 13: 100,212,669 S1384P probably damaging Het
Nav2 A G 7: 49,452,465 N337S probably benign Het
Ndn C T 7: 62,348,508 P34L probably benign Het
Neb A T 2: 52,249,281 H3107Q probably benign Het
Nebl A G 2: 17,376,651 V738A possibly damaging Het
Nsd2 G A 5: 33,882,120 R825Q possibly damaging Het
Nsun2 A G 13: 69,627,586 N383S probably damaging Het
Ntrk3 A T 7: 78,247,288 M667K probably damaging Het
Olfr389 A G 11: 73,777,148 Y60H possibly damaging Het
Olfr514 A C 7: 108,825,235 C255G probably benign Het
Olfr745 G A 14: 50,643,108 V276M possibly damaging Het
Olfr791 A T 10: 129,526,619 M131L probably benign Het
Pex6 T C 17: 46,722,632 V633A probably benign Het
Phactr1 C T 13: 42,956,671 T95M probably damaging Het
Pik3r4 A G 9: 105,687,209 D1334G probably damaging Het
Pkhd1l1 A C 15: 44,597,117 I4241L probably benign Het
Ppwd1 T C 13: 104,220,263 E248G probably damaging Het
Prepl A C 17: 85,072,081 M393R probably benign Het
Ptpn6 T C 6: 124,721,185 S532G probably benign Het
Rnase11 G T 14: 51,049,601 H165Q possibly damaging Het
Sf1 A G 19: 6,372,060 N172S possibly damaging Het
Shprh T A 10: 11,157,078 D269E probably benign Het
Slc16a1 T C 3: 104,649,482 I61T possibly damaging Het
Slc38a2 A C 15: 96,692,536 I309S probably damaging Het
Sry C G Y: 2,663,149 Q170H unknown Het
Stk3 A C 15: 35,008,308 probably null Het
Tg C A 15: 66,696,166 C1306* probably null Het
Tnik A G 3: 28,665,740 M1254V probably damaging Het
U2surp T C 9: 95,484,227 E474G possibly damaging Het
Vmn1r224 T A 17: 20,419,325 F55I probably benign Het
Vmn1r32 A G 6: 66,552,955 I279T possibly damaging Het
Zc2hc1a A G 3: 7,516,483 D15G probably benign Het
Zfp827 C A 8: 79,076,346 P516T possibly damaging Het
Zfyve9 A T 4: 108,684,907 probably null Het
Other mutations in Atp2c2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00966:Atp2c2 APN 8 119745590 missense probably benign
IGL01624:Atp2c2 APN 8 119757450 missense probably benign 0.00
IGL02133:Atp2c2 APN 8 119754335 missense probably benign 0.00
IGL02221:Atp2c2 APN 8 119744334 missense probably damaging 1.00
IGL02606:Atp2c2 APN 8 119730274 missense probably benign
IGL02657:Atp2c2 APN 8 119753032 missense probably damaging 1.00
IGL02839:Atp2c2 APN 8 119749120 missense possibly damaging 0.85
IGL03122:Atp2c2 APN 8 119742675 missense possibly damaging 0.77
R0031:Atp2c2 UTSW 8 119749062 missense probably benign 0.15
R0372:Atp2c2 UTSW 8 119757441 missense probably benign
R0502:Atp2c2 UTSW 8 119734577 missense probably null 0.99
R0503:Atp2c2 UTSW 8 119734577 missense probably null 0.99
R0584:Atp2c2 UTSW 8 119738418 missense probably benign 0.01
R1225:Atp2c2 UTSW 8 119735245 missense probably damaging 1.00
R1580:Atp2c2 UTSW 8 119752987 missense probably benign 0.00
R1620:Atp2c2 UTSW 8 119749126 missense probably benign
R1745:Atp2c2 UTSW 8 119725094 missense probably benign 0.02
R1746:Atp2c2 UTSW 8 119734443 unclassified probably benign
R1907:Atp2c2 UTSW 8 119749876 splice site probably benign
R2104:Atp2c2 UTSW 8 119749845 missense probably benign
R2151:Atp2c2 UTSW 8 119756102 missense probably benign
R2152:Atp2c2 UTSW 8 119756102 missense probably benign
R2154:Atp2c2 UTSW 8 119756102 missense probably benign
R2207:Atp2c2 UTSW 8 119748309 missense probably damaging 1.00
R3874:Atp2c2 UTSW 8 119735296 missense possibly damaging 0.74
R3912:Atp2c2 UTSW 8 119721276 missense probably damaging 1.00
R4093:Atp2c2 UTSW 8 119749871 critical splice donor site probably null
R4782:Atp2c2 UTSW 8 119749152 missense probably damaging 0.97
R4801:Atp2c2 UTSW 8 119747687 missense probably damaging 1.00
R4973:Atp2c2 UTSW 8 119754263 missense probably benign 0.00
R5485:Atp2c2 UTSW 8 119753062 critical splice donor site probably null
R5978:Atp2c2 UTSW 8 119749875 splice site probably null
R6377:Atp2c2 UTSW 8 119726354 missense probably benign 0.10
R6613:Atp2c2 UTSW 8 119756021 missense probably damaging 0.99
R6765:Atp2c2 UTSW 8 119753017 missense probably damaging 1.00
R6836:Atp2c2 UTSW 8 119734415 missense probably damaging 1.00
R6963:Atp2c2 UTSW 8 119730267 nonsense probably null
R7220:Atp2c2 UTSW 8 119745561 missense probably benign 0.00
R7238:Atp2c2 UTSW 8 119742421 missense possibly damaging 0.73
R7373:Atp2c2 UTSW 8 119730252 missense probably benign 0.02
R7438:Atp2c2 UTSW 8 119748197 missense probably damaging 1.00
R7573:Atp2c2 UTSW 8 119751269 missense probably damaging 1.00
R7677:Atp2c2 UTSW 8 119748176 missense probably benign 0.00
R7737:Atp2c2 UTSW 8 119742395 missense probably damaging 1.00
R7912:Atp2c2 UTSW 8 119730178 missense possibly damaging 0.81
R8821:Atp2c2 UTSW 8 119749294 splice site probably null
R8831:Atp2c2 UTSW 8 119749294 splice site probably null
R9200:Atp2c2 UTSW 8 119748260 nonsense probably null
R9211:Atp2c2 UTSW 8 119719293 missense probably benign
R9246:Atp2c2 UTSW 8 119730250 missense probably damaging 1.00
R9285:Atp2c2 UTSW 8 119738402 missense probably benign 0.00
RF004:Atp2c2 UTSW 8 119752822 missense probably damaging 1.00
RF012:Atp2c2 UTSW 8 119745514 missense possibly damaging 0.91
Z1177:Atp2c2 UTSW 8 119734385 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGGTACAGCTTTCATTCCATCAGGG -3'
(R):5'- AGAACAGAAGCCTGTGGACTAGCC -3'

Sequencing Primer
(F):5'- GGGCTCCAACCCACCTC -3'
(R):5'- ACTAGCCTGCCGCTCAAG -3'
Posted On 2014-04-24