Incidental Mutation 'R1638:U2surp'
ID173313
Institutional Source Beutler Lab
Gene Symbol U2surp
Ensembl Gene ENSMUSG00000032407
Gene NameU2 snRNP-associated SURP domain containing
Synonyms2610101N10Rik
MMRRC Submission 039674-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.958) question?
Stock #R1638 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location95456898-95511996 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 95484227 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 474 (E474G)
Ref Sequence ENSEMBL: ENSMUSP00000077482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078374] [ENSMUST00000079659] [ENSMUST00000191213] [ENSMUST00000217176]
Predicted Effect possibly damaging
Transcript: ENSMUST00000078374
AA Change: E474G

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000077482
Gene: ENSMUSG00000032407
AA Change: E474G

DomainStartEndE-ValueType
low complexity region 18 27 N/A INTRINSIC
low complexity region 54 75 N/A INTRINSIC
coiled coil region 148 186 N/A INTRINSIC
RRM 231 307 1.85e-18 SMART
low complexity region 313 323 N/A INTRINSIC
SWAP 384 438 1.07e-20 SMART
RPR 493 632 1.42e-41 SMART
internal_repeat_1 648 665 6.09e-7 PROSPERO
internal_repeat_1 678 698 6.09e-7 PROSPERO
coiled coil region 742 769 N/A INTRINSIC
cwf21 792 843 6.31e-17 SMART
low complexity region 881 933 N/A INTRINSIC
low complexity region 939 985 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000079659
AA Change: E518G

PolyPhen 2 Score 0.858 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000078602
Gene: ENSMUSG00000032407
AA Change: E518G

DomainStartEndE-ValueType
low complexity region 18 27 N/A INTRINSIC
low complexity region 98 119 N/A INTRINSIC
coiled coil region 192 230 N/A INTRINSIC
RRM 275 351 1.85e-18 SMART
low complexity region 357 367 N/A INTRINSIC
SWAP 428 482 1.07e-20 SMART
RPR 537 676 1.42e-41 SMART
internal_repeat_1 692 709 1.14e-6 PROSPERO
internal_repeat_1 722 742 1.14e-6 PROSPERO
coiled coil region 786 813 N/A INTRINSIC
cwf21 836 887 6.31e-17 SMART
low complexity region 925 977 N/A INTRINSIC
low complexity region 983 1029 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186139
Predicted Effect probably benign
Transcript: ENSMUST00000191213
SMART Domains Protein: ENSMUSP00000140614
Gene: ENSMUSG00000032407

DomainStartEndE-ValueType
low complexity region 18 27 N/A INTRINSIC
low complexity region 98 119 N/A INTRINSIC
coiled coil region 192 230 N/A INTRINSIC
RRM 275 351 7.8e-21 SMART
low complexity region 357 367 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000217176
AA Change: E517G

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
Meta Mutation Damage Score 0.1135 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 94.9%
  • 20x: 87.8%
Validation Efficiency 99% (79/80)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik C T 3: 37,035,812 R4130* probably null Het
A2m C A 6: 121,654,612 L623M probably benign Het
Adamts13 A G 2: 26,996,583 E938G possibly damaging Het
Agfg1 A T 1: 82,893,538 Q497L probably damaging Het
Ahnak A G 19: 9,009,449 H2699R probably benign Het
Antxrl G T 14: 34,070,496 probably null Het
Apol7c A T 15: 77,526,218 V176E probably damaging Het
Arid5b T C 10: 68,277,947 N87D possibly damaging Het
Atp2c1 A T 9: 105,432,698 I560N probably damaging Het
Atp2c2 T C 8: 119,756,003 F868S possibly damaging Het
Blnk G C 19: 40,937,678 F326L probably benign Het
Ckap2 C T 8: 22,175,796 V412I possibly damaging Het
Clmn A G 12: 104,782,022 V422A probably benign Het
Ctnnal1 A G 4: 56,813,856 S638P probably benign Het
Cyp2j5 T C 4: 96,635,815 S327G probably benign Het
Dhx38 G A 8: 109,553,545 T871M probably damaging Het
Dmxl1 A T 18: 49,890,767 K1706* probably null Het
Dnah11 A G 12: 118,015,419 L2648P possibly damaging Het
Elf2 G A 3: 51,308,109 T60I probably damaging Het
Fam120b T A 17: 15,402,497 C246S possibly damaging Het
Fcho2 G T 13: 98,745,895 T451K possibly damaging Het
Fzd9 T A 5: 135,249,748 I428F probably damaging Het
Galnt13 T A 2: 54,854,655 V122E probably damaging Het
Gm21738 T A 14: 19,418,908 Y8F probably benign Het
Gnptab A G 10: 88,436,167 I940V possibly damaging Het
Gp2 A G 7: 119,451,498 probably null Het
Gpr6 A G 10: 41,070,534 S351P probably benign Het
Gprin1 T C 13: 54,739,876 E195G possibly damaging Het
Grm8 A T 6: 28,125,883 Y81* probably null Het
Gtf3c3 A T 1: 54,405,119 N703K probably damaging Het
H2afy T A 13: 56,104,909 N87Y probably damaging Het
Hhipl2 G A 1: 183,428,013 V495I probably benign Het
Islr G A 9: 58,158,219 probably benign Het
Lrrc36 T C 8: 105,449,641 Y216H possibly damaging Het
Me2 A G 18: 73,773,134 I528T probably benign Het
Mecr A T 4: 131,857,816 I156F possibly damaging Het
Megf6 A G 4: 154,262,510 probably benign Het
Mn1 T A 5: 111,421,569 L1135H probably damaging Het
Naip5 A G 13: 100,212,669 S1384P probably damaging Het
Nav2 A G 7: 49,452,465 N337S probably benign Het
Ndn C T 7: 62,348,508 P34L probably benign Het
Neb A T 2: 52,249,281 H3107Q probably benign Het
Nebl A G 2: 17,376,651 V738A possibly damaging Het
Nsd2 G A 5: 33,882,120 R825Q possibly damaging Het
Nsun2 A G 13: 69,627,586 N383S probably damaging Het
Ntrk3 A T 7: 78,247,288 M667K probably damaging Het
Olfr389 A G 11: 73,777,148 Y60H possibly damaging Het
Olfr514 A C 7: 108,825,235 C255G probably benign Het
Olfr745 G A 14: 50,643,108 V276M possibly damaging Het
Olfr791 A T 10: 129,526,619 M131L probably benign Het
Pex6 T C 17: 46,722,632 V633A probably benign Het
Phactr1 C T 13: 42,956,671 T95M probably damaging Het
Pik3r4 A G 9: 105,687,209 D1334G probably damaging Het
Pkhd1l1 A C 15: 44,597,117 I4241L probably benign Het
Ppwd1 T C 13: 104,220,263 E248G probably damaging Het
Prepl A C 17: 85,072,081 M393R probably benign Het
Ptpn6 T C 6: 124,721,185 S532G probably benign Het
Rnase11 G T 14: 51,049,601 H165Q possibly damaging Het
Sf1 A G 19: 6,372,060 N172S possibly damaging Het
Shprh T A 10: 11,157,078 D269E probably benign Het
Slc16a1 T C 3: 104,649,482 I61T possibly damaging Het
Slc38a2 A C 15: 96,692,536 I309S probably damaging Het
Sry C G Y: 2,663,149 Q170H unknown Het
Stk3 A C 15: 35,008,308 probably null Het
Tg C A 15: 66,696,166 C1306* probably null Het
Tnik A G 3: 28,665,740 M1254V probably damaging Het
Vmn1r224 T A 17: 20,419,325 F55I probably benign Het
Vmn1r32 A G 6: 66,552,955 I279T possibly damaging Het
Zc2hc1a A G 3: 7,516,483 D15G probably benign Het
Zfp827 C A 8: 79,076,346 P516T possibly damaging Het
Zfyve9 A T 4: 108,684,907 probably null Het
Other mutations in U2surp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00583:U2surp APN 9 95461524 utr 3 prime probably benign
IGL01122:U2surp APN 9 95490234 missense probably benign 0.02
IGL01985:U2surp APN 9 95490226 missense probably damaging 1.00
IGL01992:U2surp APN 9 95464419 missense possibly damaging 0.46
IGL01992:U2surp APN 9 95482181 missense probably damaging 0.99
IGL02300:U2surp APN 9 95488770 missense probably damaging 1.00
IGL02491:U2surp APN 9 95490220 missense probably damaging 0.98
IGL02503:U2surp APN 9 95502569 missense probably benign 0.03
IGL02615:U2surp APN 9 95493231 missense probably benign 0.00
IGL02628:U2surp APN 9 95472090 missense possibly damaging 0.89
IGL02682:U2surp APN 9 95481651 critical splice donor site probably null
IGL02721:U2surp APN 9 95474435 missense probably benign 0.10
IGL03200:U2surp APN 9 95491391 nonsense probably null
coup UTSW 9 95477512 missense probably damaging 1.00
R0095:U2surp UTSW 9 95500684 splice site probably null
R0373:U2surp UTSW 9 95484443 missense probably benign 0.08
R0376:U2surp UTSW 9 95484443 missense probably benign 0.08
R0377:U2surp UTSW 9 95484443 missense probably benign 0.08
R0416:U2surp UTSW 9 95485607 missense probably damaging 1.00
R0682:U2surp UTSW 9 95484443 missense probably benign 0.08
R0948:U2surp UTSW 9 95461497 utr 3 prime probably benign
R1420:U2surp UTSW 9 95462803 missense probably benign 0.33
R1474:U2surp UTSW 9 95493198 missense possibly damaging 0.49
R1555:U2surp UTSW 9 95466577 missense probably damaging 1.00
R1597:U2surp UTSW 9 95481740 splice site probably benign
R1693:U2surp UTSW 9 95511860 start codon destroyed probably null 0.53
R1851:U2surp UTSW 9 95482097 nonsense probably null
R2271:U2surp UTSW 9 95491420 missense possibly damaging 0.80
R2679:U2surp UTSW 9 95476232 missense possibly damaging 0.82
R2851:U2surp UTSW 9 95500682 splice site probably null
R3769:U2surp UTSW 9 95493697 splice site probably benign
R4596:U2surp UTSW 9 95485628 missense probably damaging 1.00
R4672:U2surp UTSW 9 95493145 missense possibly damaging 0.83
R4763:U2surp UTSW 9 95511791 intron probably benign
R4995:U2surp UTSW 9 95462794 utr 3 prime probably benign
R5805:U2surp UTSW 9 95479304 missense possibly damaging 0.51
R6006:U2surp UTSW 9 95479307 missense probably damaging 0.96
R6249:U2surp UTSW 9 95500816 missense probably benign 0.07
R6260:U2surp UTSW 9 95476157 missense probably damaging 0.99
R6378:U2surp UTSW 9 95491421 missense probably benign 0.41
R6487:U2surp UTSW 9 95477512 missense probably damaging 1.00
R6585:U2surp UTSW 9 95472071 missense probably damaging 1.00
R6721:U2surp UTSW 9 95491104 missense probably damaging 0.99
R6760:U2surp UTSW 9 95493711 missense probably benign 0.27
R7065:U2surp UTSW 9 95485659 missense probably benign 0.01
R7167:U2surp UTSW 9 95481673 missense probably damaging 0.98
R7219:U2surp UTSW 9 95490162 nonsense probably null
R7232:U2surp UTSW 9 95493717 missense probably benign 0.03
R7460:U2surp UTSW 9 95462824 missense unknown
R7547:U2surp UTSW 9 95479349 missense possibly damaging 0.94
R7609:U2surp UTSW 9 95485679 splice site probably null
R7761:U2surp UTSW 9 95488761 missense probably damaging 1.00
R8520:U2surp UTSW 9 95502554 missense possibly damaging 0.88
X0018:U2surp UTSW 9 95475288 missense probably benign 0.14
X0018:U2surp UTSW 9 95485597 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ATGCATAGCCAATGCCTGACCC -3'
(R):5'- GCCCATGTTTACTACAGGTGGAAGC -3'

Sequencing Primer
(F):5'- AACAGTCTCTGGGTAATCTGTGTAAG -3'
(R):5'- GCAGGCAAGTAGGATTAATTACTC -3'
Posted On2014-04-24