Mutagenetix > Incidental Mutation

Incidental Mutation 'R1638:Atp2c1'

173314

Institutional Source

Beutler Lab

Gene Symbol

Atp2c1

Ensembl Gene

ENSMUSG00000032570

Gene Name

ATPase, Ca++-sequestering

Synonyms

D930003G21Rik, SPCA, ATP2C1A, PMR1, 1700121J11Rik

MMRRC Submission

039674-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.258) question?

Stock #

R1638 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

105403539-105527319 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 105432698 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 560 (I560N)

Ref Sequence

ENSEMBL: ENSMUSP00000134764 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038118] [ENSMUST00000085133] [ENSMUST00000112558] [ENSMUST00000163879] [ENSMUST00000176770] [ENSMUST00000177074] [ENSMUST00000177293]

AlphaFold

Q80XR2

Predicted Effect

possibly damaging
Transcript: ENSMUST00000038118
AA Change: I565N

PolyPhen 2 Score 0.874 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000039103
Gene: ENSMUSG00000032570
AA Change: I565N

Domain	Start	End	E-Value	Type
Cation_ATPase_N	25	99	1.85e-14	SMART
Pfam:E1-E2_ATPase	105	339	2.3e-75	PFAM
Pfam:Hydrolase	343	655	2.9e-31	PFAM
Pfam:HAD	346	652	7.7e-15	PFAM
Pfam:Hydrolase_like2	408	492	9.5e-20	PFAM
low complexity region	706	721	N/A	INTRINSIC
Pfam:Cation_ATPase_C	725	897	4e-47	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000085133
AA Change: I599N

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000082220
Gene: ENSMUSG00000032570
AA Change: I599N

Domain	Start	End	E-Value	Type
Cation_ATPase_N	59	133	1.85e-14	SMART
Pfam:E1-E2_ATPase	138	372	3.4e-62	PFAM
Pfam:Hydrolase	377	689	2.6e-23	PFAM
Pfam:HAD	380	686	7.8e-14	PFAM
Pfam:Cation_ATPase	442	526	3.2e-19	PFAM
low complexity region	740	755	N/A	INTRINSIC
Pfam:Cation_ATPase_C	759	931	3.8e-48	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000112557

Predicted Effect

possibly damaging
Transcript: ENSMUST00000112558
AA Change: I565N

PolyPhen 2 Score 0.874 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000108177
Gene: ENSMUSG00000032570
AA Change: I565N

Domain	Start	End	E-Value	Type
Cation_ATPase_N	25	99	1.85e-14	SMART
Pfam:E1-E2_ATPase	105	339	2.3e-75	PFAM
Pfam:Hydrolase	343	655	2.9e-31	PFAM
Pfam:HAD	346	652	7.7e-15	PFAM
Pfam:Hydrolase_like2	408	492	9.5e-20	PFAM
low complexity region	706	721	N/A	INTRINSIC
Pfam:Cation_ATPase_C	725	897	4e-47	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000163879
AA Change: I549N

PolyPhen 2 Score 0.874 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000129617
Gene: ENSMUSG00000032570
AA Change: I549N

Domain	Start	End	E-Value	Type
Cation_ATPase_N	9	83	1.85e-14	SMART
Pfam:E1-E2_ATPase	89	323	5.2e-76	PFAM
Pfam:Hydrolase	327	639	5.6e-32	PFAM
Pfam:HAD	330	636	1.4e-15	PFAM
Pfam:Hydrolase_like2	392	476	3.2e-20	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176656

Predicted Effect

probably damaging
Transcript: ENSMUST00000176770
AA Change: I560N

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000134764
Gene: ENSMUSG00000032570
AA Change: I560N

Domain	Start	End	E-Value	Type
Pfam:E1-E2_ATPase	100	334	8.9e-76	PFAM
Pfam:Hydrolase	338	650	1.1e-31	PFAM
Pfam:HAD	341	647	2.7e-15	PFAM
Pfam:Hydrolase_like2	403	487	4.8e-20	PFAM
low complexity region	701	716	N/A	INTRINSIC
Pfam:Cation_ATPase_C	720	892	1.6e-47	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000177000

Predicted Effect

possibly damaging
Transcript: ENSMUST00000177074
AA Change: I565N

PolyPhen 2 Score 0.874 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000135646
Gene: ENSMUSG00000032570
AA Change: I565N

Domain	Start	End	E-Value	Type
Cation_ATPase_N	25	99	1.85e-14	SMART
Pfam:E1-E2_ATPase	105	339	8.2e-76	PFAM
Pfam:Hydrolase	343	655	1e-31	PFAM
Pfam:HAD	346	652	2.5e-15	PFAM
Pfam:Hydrolase_like2	408	492	4.5e-20	PFAM
low complexity region	706	721	N/A	INTRINSIC
Pfam:Cation_ATPase_C	725	886	7e-44	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000177293
AA Change: I429N

PolyPhen 2 Score 0.874 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000135802
Gene: ENSMUSG00000032570
AA Change: I429N

Domain	Start	End	E-Value	Type
Pfam:E1-E2_ATPase	1	203	6.7e-64	PFAM
Pfam:Hydrolase	207	519	7.4e-32	PFAM
Pfam:HAD	210	516	1.9e-15	PFAM
Pfam:Hydrolase_like2	272	356	3.8e-20	PFAM
transmembrane domain	564	586	N/A	INTRINSIC
Pfam:Cation_ATPase_C	589	761	1.2e-47	PFAM

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.0%
3x: 97.9%
10x: 94.9%
20x: 87.8%

Validation Efficiency

99% (79/80)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases. This magnesium-dependent enzyme catalyzes the hydrolysis of ATP coupled with the transport of calcium ions. Defects in this gene cause Hailey-Hailey disease, an autosomal dominant disorder. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a knock-out allele show embryonic growth retardation, failure of rostral neural tube closure, Golgi and endoplasmic reticulum stress, increased apoptosis, accumulation of intracellular lipid droplets and midgestational lethality. Agedheterozygotes develop squamous cell tumors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	C	T	3: 37,035,812	R4130*	probably null	Het
A2m	C	A	6: 121,654,612	L623M	probably benign	Het
Adamts13	A	G	2: 26,996,583	E938G	possibly damaging	Het
Agfg1	A	T	1: 82,893,538	Q497L	probably damaging	Het
Ahnak	A	G	19: 9,009,449	H2699R	probably benign	Het
Antxrl	G	T	14: 34,070,496		probably null	Het
Apol7c	A	T	15: 77,526,218	V176E	probably damaging	Het
Arid5b	T	C	10: 68,277,947	N87D	possibly damaging	Het
Atp2c2	T	C	8: 119,756,003	F868S	possibly damaging	Het
Blnk	G	C	19: 40,937,678	F326L	probably benign	Het
Ckap2	C	T	8: 22,175,796	V412I	possibly damaging	Het
Clmn	A	G	12: 104,782,022	V422A	probably benign	Het
Ctnnal1	A	G	4: 56,813,856	S638P	probably benign	Het
Cyp2j5	T	C	4: 96,635,815	S327G	probably benign	Het
Dhx38	G	A	8: 109,553,545	T871M	probably damaging	Het
Dmxl1	A	T	18: 49,890,767	K1706*	probably null	Het
Dnah11	A	G	12: 118,015,419	L2648P	possibly damaging	Het
Elf2	G	A	3: 51,308,109	T60I	probably damaging	Het
Fam120b	T	A	17: 15,402,497	C246S	possibly damaging	Het
Fcho2	G	T	13: 98,745,895	T451K	possibly damaging	Het
Fzd9	T	A	5: 135,249,748	I428F	probably damaging	Het
Galnt13	T	A	2: 54,854,655	V122E	probably damaging	Het
Gm21738	T	A	14: 19,418,908	Y8F	probably benign	Het
Gnptab	A	G	10: 88,436,167	I940V	possibly damaging	Het
Gp2	A	G	7: 119,451,498		probably null	Het
Gpr6	A	G	10: 41,070,534	S351P	probably benign	Het
Gprin1	T	C	13: 54,739,876	E195G	possibly damaging	Het
Grm8	A	T	6: 28,125,883	Y81*	probably null	Het
Gtf3c3	A	T	1: 54,405,119	N703K	probably damaging	Het
H2afy	T	A	13: 56,104,909	N87Y	probably damaging	Het
Hhipl2	G	A	1: 183,428,013	V495I	probably benign	Het
Islr	G	A	9: 58,158,219		probably benign	Het
Lrrc36	T	C	8: 105,449,641	Y216H	possibly damaging	Het
Me2	A	G	18: 73,773,134	I528T	probably benign	Het
Mecr	A	T	4: 131,857,816	I156F	possibly damaging	Het
Megf6	A	G	4: 154,262,510		probably benign	Het
Mn1	T	A	5: 111,421,569	L1135H	probably damaging	Het
Naip5	A	G	13: 100,212,669	S1384P	probably damaging	Het
Nav2	A	G	7: 49,452,465	N337S	probably benign	Het
Ndn	C	T	7: 62,348,508	P34L	probably benign	Het
Neb	A	T	2: 52,249,281	H3107Q	probably benign	Het
Nebl	A	G	2: 17,376,651	V738A	possibly damaging	Het
Nsd2	G	A	5: 33,882,120	R825Q	possibly damaging	Het
Nsun2	A	G	13: 69,627,586	N383S	probably damaging	Het
Ntrk3	A	T	7: 78,247,288	M667K	probably damaging	Het
Olfr389	A	G	11: 73,777,148	Y60H	possibly damaging	Het
Olfr514	A	C	7: 108,825,235	C255G	probably benign	Het
Olfr745	G	A	14: 50,643,108	V276M	possibly damaging	Het
Olfr791	A	T	10: 129,526,619	M131L	probably benign	Het
Pex6	T	C	17: 46,722,632	V633A	probably benign	Het
Phactr1	C	T	13: 42,956,671	T95M	probably damaging	Het
Pik3r4	A	G	9: 105,687,209	D1334G	probably damaging	Het
Pkhd1l1	A	C	15: 44,597,117	I4241L	probably benign	Het
Ppwd1	T	C	13: 104,220,263	E248G	probably damaging	Het
Prepl	A	C	17: 85,072,081	M393R	probably benign	Het
Ptpn6	T	C	6: 124,721,185	S532G	probably benign	Het
Rnase11	G	T	14: 51,049,601	H165Q	possibly damaging	Het
Sf1	A	G	19: 6,372,060	N172S	possibly damaging	Het
Shprh	T	A	10: 11,157,078	D269E	probably benign	Het
Slc16a1	T	C	3: 104,649,482	I61T	possibly damaging	Het
Slc38a2	A	C	15: 96,692,536	I309S	probably damaging	Het
Sry	C	G	Y: 2,663,149	Q170H	unknown	Het
Stk3	A	C	15: 35,008,308		probably null	Het
Tg	C	A	15: 66,696,166	C1306*	probably null	Het
Tnik	A	G	3: 28,665,740	M1254V	probably damaging	Het
U2surp	T	C	9: 95,484,227	E474G	possibly damaging	Het
Vmn1r224	T	A	17: 20,419,325	F55I	probably benign	Het
Vmn1r32	A	G	6: 66,552,955	I279T	possibly damaging	Het
Zc2hc1a	A	G	3: 7,516,483	D15G	probably benign	Het
Zfp827	C	A	8: 79,076,346	P516T	possibly damaging	Het
Zfyve9	A	T	4: 108,684,907		probably null	Het

Other mutations in Atp2c1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00984:Atp2c1	APN	9	105418579	missense	probably damaging	1.00
IGL01682:Atp2c1	APN	9	105452842	missense	probably damaging	1.00
IGL01874:Atp2c1	APN	9	105448825	missense	probably damaging	1.00
IGL02299:Atp2c1	APN	9	105461087	unclassified	probably benign
IGL03186:Atp2c1	APN	9	105413130	missense	probably benign	0.10
IGL03212:Atp2c1	APN	9	105445267	missense	probably damaging	1.00
BB002:Atp2c1	UTSW	9	105442770	missense	possibly damaging	0.92
BB012:Atp2c1	UTSW	9	105442770	missense	possibly damaging	0.92
IGL02799:Atp2c1	UTSW	9	105413043	unclassified	probably benign
IGL03047:Atp2c1	UTSW	9	105521007	intron	probably benign
R0885:Atp2c1	UTSW	9	105421573	critical splice donor site	probably null
R1072:Atp2c1	UTSW	9	105459744	missense	possibly damaging	0.92
R1469:Atp2c1	UTSW	9	105435152	nonsense	probably null
R1469:Atp2c1	UTSW	9	105435152	nonsense	probably null
R1611:Atp2c1	UTSW	9	105442852	missense	probably damaging	0.98
R1667:Atp2c1	UTSW	9	105432797	missense	probably null	0.94
R1722:Atp2c1	UTSW	9	105439400	missense	probably benign	0.01
R1734:Atp2c1	UTSW	9	105414655	missense	probably damaging	1.00
R1782:Atp2c1	UTSW	9	105431587	missense	probably damaging	0.99
R1964:Atp2c1	UTSW	9	105446123	missense	probably damaging	1.00
R2008:Atp2c1	UTSW	9	105432726	missense	probably benign	0.00
R2093:Atp2c1	UTSW	9	105418121	nonsense	probably null
R3720:Atp2c1	UTSW	9	105422976	missense	probably damaging	1.00
R4118:Atp2c1	UTSW	9	105466659	missense	probably damaging	1.00
R4273:Atp2c1	UTSW	9	105435140	missense	probably benign	0.10
R4763:Atp2c1	UTSW	9	105418567	missense	probably damaging	1.00
R4962:Atp2c1	UTSW	9	105442950	missense	probably benign	0.03
R5121:Atp2c1	UTSW	9	105448825	missense	probably damaging	1.00
R5458:Atp2c1	UTSW	9	105414725	nonsense	probably null
R5551:Atp2c1	UTSW	9	105459737	missense	probably damaging	1.00
R6198:Atp2c1	UTSW	9	105521072	missense	probably benign	0.00
R6414:Atp2c1	UTSW	9	105466656	missense	probably damaging	1.00
R6432:Atp2c1	UTSW	9	105445313	missense	probably damaging	1.00
R6675:Atp2c1	UTSW	9	105453533	critical splice donor site	probably null
R6719:Atp2c1	UTSW	9	105424178	missense	probably damaging	1.00
R6777:Atp2c1	UTSW	9	105418600	missense	possibly damaging	0.64
R6847:Atp2c1	UTSW	9	105418579	missense	probably damaging	1.00
R6870:Atp2c1	UTSW	9	105470062	missense	probably benign	0.13
R7097:Atp2c1	UTSW	9	105464651	missense	probably damaging	1.00
R7120:Atp2c1	UTSW	9	105420186	nonsense	probably null
R7216:Atp2c1	UTSW	9	105467731	missense	probably benign	0.00
R7284:Atp2c1	UTSW	9	105520809	splice site	probably null
R7365:Atp2c1	UTSW	9	105422999	missense	probably damaging	1.00
R7448:Atp2c1	UTSW	9	105452783	missense	probably damaging	0.98
R7818:Atp2c1	UTSW	9	105414757	missense	probably benign	0.06
R7921:Atp2c1	UTSW	9	105414687	missense	probably damaging	1.00
R7925:Atp2c1	UTSW	9	105442770	missense	possibly damaging	0.92
R8088:Atp2c1	UTSW	9	105452569	splice site	probably null
R8257:Atp2c1	UTSW	9	105431557	missense	probably benign	0.40
R8260:Atp2c1	UTSW	9	105418579	missense	probably damaging	1.00
R8265:Atp2c1	UTSW	9	105470116	missense	probably benign	0.01
R8307:Atp2c1	UTSW	9	105442831	missense	probably benign
R9052:Atp2c1	UTSW	9	105452833	missense	probably damaging	0.99
R9066:Atp2c1	UTSW	9	105453646	missense	probably damaging	1.00
R9177:Atp2c1	UTSW	9	105459659	critical splice donor site	probably null
R9257:Atp2c1	UTSW	9	105414652	nonsense	probably null
R9566:Atp2c1	UTSW	9	105466629	missense	probably damaging	0.97
R9779:Atp2c1	UTSW	9	105414720	missense	probably damaging	0.98
X0053:Atp2c1	UTSW	9	105418684	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGCACATCCCTGATGGTAACAGACA -3'
(R):5'- AGGCTTTCACAACCAGTATTTTGCAGT -3'

Sequencing Primer
(F):5'- AAAGGTCAACTACCCTTCTGTG -3'
(R):5'- AAGTTCTTGCCTTGGCGTCT -3'

Posted On

2014-04-24