Mutagenetix > Incidental Mutation

Incidental Mutation 'R1638:Shprh'

173316

Institutional Source

Beutler Lab

Gene Symbol

Shprh

Ensembl Gene

ENSMUSG00000090112

Gene Name

SNF2 histone linker PHD RING helicase

Synonyms

2610103K11Rik, D230017O13Rik

MMRRC Submission

039674-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1638 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

11149427-11217595 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 11157078 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 269 (D269E)

Ref Sequence

ENSEMBL: ENSMUSP00000125457 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044053] [ENSMUST00000054814] [ENSMUST00000159541] [ENSMUST00000159810]

AlphaFold

Q7TPQ3

Predicted Effect

probably benign
Transcript: ENSMUST00000044053
AA Change: D269E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000039422
Gene: ENSMUSG00000090112
AA Change: D269E

Domain	Start	End	E-Value	Type
low complexity region	42	56	N/A	INTRINSIC
Blast:DEXDc	195	250	3e-12	BLAST
low complexity region	253	265	N/A	INTRINSIC
DEXDc	295	866	4.02e-17	SMART
H15	431	497	3.76e-5	SMART
PHD	651	698	2.33e-5	SMART
low complexity region	1393	1404	N/A	INTRINSIC
RING	1423	1469	9.68e-3	SMART
Pfam:Helicase_C	1500	1613	1.6e-8	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000054814
AA Change: D269E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000125849
Gene: ENSMUSG00000090112
AA Change: D269E

Domain	Start	End	E-Value	Type
low complexity region	42	56	N/A	INTRINSIC
Blast:DEXDc	195	250	3e-12	BLAST
low complexity region	253	265	N/A	INTRINSIC
DEXDc	295	866	4.02e-17	SMART
H15	431	497	3.76e-5	SMART
PHD	651	698	2.33e-5	SMART
low complexity region	1393	1404	N/A	INTRINSIC
RING	1423	1469	9.68e-3	SMART
SCOP:d1fuka_	1504	1616	6e-8	SMART
Blast:HELICc	1533	1613	4e-46	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000159541
AA Change: D269E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000132870
Gene: ENSMUSG00000090112
AA Change: D269E

Domain	Start	End	E-Value	Type
low complexity region	42	56	N/A	INTRINSIC
Blast:DEXDc	195	250	3e-12	BLAST
low complexity region	253	265	N/A	INTRINSIC
DEXDc	295	866	4.02e-17	SMART
H15	431	497	3.76e-5	SMART
PHD	651	698	2.33e-5	SMART
low complexity region	1393	1404	N/A	INTRINSIC
RING	1423	1469	9.68e-3	SMART
SCOP:d1fuka_	1504	1619	4e-8	SMART
Blast:HELICc	1533	1613	6e-46	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000159810
AA Change: D269E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000125457
Gene: ENSMUSG00000090112
AA Change: D269E

Domain	Start	End	E-Value	Type
low complexity region	42	56	N/A	INTRINSIC
Blast:DEXDc	195	250	2e-12	BLAST
low complexity region	253	265	N/A	INTRINSIC
DEXDc	295	866	4.02e-17	SMART
H15	431	497	3.76e-5	SMART
PHD	651	698	2.33e-5	SMART
Blast:DEXDc	948	1026	2e-9	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161858

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.0%
3x: 97.9%
10x: 94.9%
20x: 87.8%

Validation Efficiency

99% (79/80)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SHPRH is a ubiquitously expressed protein that contains motifs characteristics of several DNA repair proteins, transcription factors, and helicases. SHPRH is a functional homolog of S. cerevisiae RAD5 (Unk et al., 2006 [PubMed 17108083]).[supplied by OMIM, Mar 2008]
PHENOTYPE: The gene product is an E3 ligase involved in poly-ubiquitination of Pcna. Neither homozygous truncation nor KO affect B cell somatic hypermutation or class switching. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	C	T	3: 37,035,812	R4130*	probably null	Het
A2m	C	A	6: 121,654,612	L623M	probably benign	Het
Adamts13	A	G	2: 26,996,583	E938G	possibly damaging	Het
Agfg1	A	T	1: 82,893,538	Q497L	probably damaging	Het
Ahnak	A	G	19: 9,009,449	H2699R	probably benign	Het
Antxrl	G	T	14: 34,070,496		probably null	Het
Apol7c	A	T	15: 77,526,218	V176E	probably damaging	Het
Arid5b	T	C	10: 68,277,947	N87D	possibly damaging	Het
Atp2c1	A	T	9: 105,432,698	I560N	probably damaging	Het
Atp2c2	T	C	8: 119,756,003	F868S	possibly damaging	Het
Blnk	G	C	19: 40,937,678	F326L	probably benign	Het
Ckap2	C	T	8: 22,175,796	V412I	possibly damaging	Het
Clmn	A	G	12: 104,782,022	V422A	probably benign	Het
Ctnnal1	A	G	4: 56,813,856	S638P	probably benign	Het
Cyp2j5	T	C	4: 96,635,815	S327G	probably benign	Het
Dhx38	G	A	8: 109,553,545	T871M	probably damaging	Het
Dmxl1	A	T	18: 49,890,767	K1706*	probably null	Het
Dnah11	A	G	12: 118,015,419	L2648P	possibly damaging	Het
Elf2	G	A	3: 51,308,109	T60I	probably damaging	Het
Fam120b	T	A	17: 15,402,497	C246S	possibly damaging	Het
Fcho2	G	T	13: 98,745,895	T451K	possibly damaging	Het
Fzd9	T	A	5: 135,249,748	I428F	probably damaging	Het
Galnt13	T	A	2: 54,854,655	V122E	probably damaging	Het
Gm21738	T	A	14: 19,418,908	Y8F	probably benign	Het
Gnptab	A	G	10: 88,436,167	I940V	possibly damaging	Het
Gp2	A	G	7: 119,451,498		probably null	Het
Gpr6	A	G	10: 41,070,534	S351P	probably benign	Het
Gprin1	T	C	13: 54,739,876	E195G	possibly damaging	Het
Grm8	A	T	6: 28,125,883	Y81*	probably null	Het
Gtf3c3	A	T	1: 54,405,119	N703K	probably damaging	Het
H2afy	T	A	13: 56,104,909	N87Y	probably damaging	Het
Hhipl2	G	A	1: 183,428,013	V495I	probably benign	Het
Islr	G	A	9: 58,158,219		probably benign	Het
Lrrc36	T	C	8: 105,449,641	Y216H	possibly damaging	Het
Me2	A	G	18: 73,773,134	I528T	probably benign	Het
Mecr	A	T	4: 131,857,816	I156F	possibly damaging	Het
Megf6	A	G	4: 154,262,510		probably benign	Het
Mn1	T	A	5: 111,421,569	L1135H	probably damaging	Het
Naip5	A	G	13: 100,212,669	S1384P	probably damaging	Het
Nav2	A	G	7: 49,452,465	N337S	probably benign	Het
Ndn	C	T	7: 62,348,508	P34L	probably benign	Het
Neb	A	T	2: 52,249,281	H3107Q	probably benign	Het
Nebl	A	G	2: 17,376,651	V738A	possibly damaging	Het
Nsd2	G	A	5: 33,882,120	R825Q	possibly damaging	Het
Nsun2	A	G	13: 69,627,586	N383S	probably damaging	Het
Ntrk3	A	T	7: 78,247,288	M667K	probably damaging	Het
Olfr389	A	G	11: 73,777,148	Y60H	possibly damaging	Het
Olfr514	A	C	7: 108,825,235	C255G	probably benign	Het
Olfr745	G	A	14: 50,643,108	V276M	possibly damaging	Het
Olfr791	A	T	10: 129,526,619	M131L	probably benign	Het
Pex6	T	C	17: 46,722,632	V633A	probably benign	Het
Phactr1	C	T	13: 42,956,671	T95M	probably damaging	Het
Pik3r4	A	G	9: 105,687,209	D1334G	probably damaging	Het
Pkhd1l1	A	C	15: 44,597,117	I4241L	probably benign	Het
Ppwd1	T	C	13: 104,220,263	E248G	probably damaging	Het
Prepl	A	C	17: 85,072,081	M393R	probably benign	Het
Ptpn6	T	C	6: 124,721,185	S532G	probably benign	Het
Rnase11	G	T	14: 51,049,601	H165Q	possibly damaging	Het
Sf1	A	G	19: 6,372,060	N172S	possibly damaging	Het
Slc16a1	T	C	3: 104,649,482	I61T	possibly damaging	Het
Slc38a2	A	C	15: 96,692,536	I309S	probably damaging	Het
Sry	C	G	Y: 2,663,149	Q170H	unknown	Het
Stk3	A	C	15: 35,008,308		probably null	Het
Tg	C	A	15: 66,696,166	C1306*	probably null	Het
Tnik	A	G	3: 28,665,740	M1254V	probably damaging	Het
U2surp	T	C	9: 95,484,227	E474G	possibly damaging	Het
Vmn1r224	T	A	17: 20,419,325	F55I	probably benign	Het
Vmn1r32	A	G	6: 66,552,955	I279T	possibly damaging	Het
Zc2hc1a	A	G	3: 7,516,483	D15G	probably benign	Het
Zfp827	C	A	8: 79,076,346	P516T	possibly damaging	Het
Zfyve9	A	T	4: 108,684,907		probably null	Het

Other mutations in Shprh

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00492:Shprh	APN	10	11188158	missense	probably damaging	1.00
IGL00583:Shprh	APN	10	11188020	missense	probably benign	0.37
IGL00684:Shprh	APN	10	11163037	missense	probably benign	0.11
IGL01295:Shprh	APN	10	11183868	missense	probably damaging	0.96
IGL01387:Shprh	APN	10	11170254	missense	probably damaging	1.00
IGL01635:Shprh	APN	10	11170019	nonsense	probably null
IGL01833:Shprh	APN	10	11191062	missense	probably damaging	1.00
IGL02013:Shprh	APN	10	11181502	splice site	probably benign
IGL02502:Shprh	APN	10	11194357	missense	possibly damaging	0.66
IGL02819:Shprh	APN	10	11154765	missense	possibly damaging	0.93
PIT4581001:Shprh	UTSW	10	11192494	frame shift	probably null
R0010:Shprh	UTSW	10	11151931	missense	probably benign
R0010:Shprh	UTSW	10	11151931	missense	probably benign
R0053:Shprh	UTSW	10	11194372	splice site	probably null
R0053:Shprh	UTSW	10	11194372	splice site	probably null
R0255:Shprh	UTSW	10	11186391	missense	possibly damaging	0.92
R0325:Shprh	UTSW	10	11170109	missense	probably benign	0.00
R0331:Shprh	UTSW	10	11194170	splice site	probably benign
R0494:Shprh	UTSW	10	11157191	missense	probably damaging	1.00
R0532:Shprh	UTSW	10	11162812	missense	possibly damaging	0.90
R0546:Shprh	UTSW	10	11183887	splice site	probably benign
R0574:Shprh	UTSW	10	11163077	unclassified	probably benign
R0605:Shprh	UTSW	10	11207112	missense	probably damaging	1.00
R0662:Shprh	UTSW	10	11186847	missense	probably damaging	1.00
R1148:Shprh	UTSW	10	11213482	missense	possibly damaging	0.95
R1148:Shprh	UTSW	10	11213482	missense	possibly damaging	0.95
R1263:Shprh	UTSW	10	11159530	missense	probably damaging	1.00
R1588:Shprh	UTSW	10	11164744	missense	probably damaging	1.00
R1830:Shprh	UTSW	10	11186911	splice site	probably null
R1898:Shprh	UTSW	10	11186869	missense	probably damaging	1.00
R1903:Shprh	UTSW	10	11183797	nonsense	probably null
R2060:Shprh	UTSW	10	11152120	missense	probably benign	0.03
R2225:Shprh	UTSW	10	11162235	unclassified	probably benign
R2363:Shprh	UTSW	10	11171953	missense	probably damaging	1.00
R2509:Shprh	UTSW	10	11166724	missense	probably damaging	1.00
R2891:Shprh	UTSW	10	11164356	missense	probably damaging	1.00
R3077:Shprh	UTSW	10	11170413	missense	probably damaging	1.00
R3150:Shprh	UTSW	10	11170030	missense	probably damaging	0.97
R3796:Shprh	UTSW	10	11178757	missense	possibly damaging	0.89
R4196:Shprh	UTSW	10	11207860	utr 3 prime	probably benign
R4423:Shprh	UTSW	10	11186518	missense	possibly damaging	0.82
R4488:Shprh	UTSW	10	11160471	missense	probably benign	0.17
R4748:Shprh	UTSW	10	11170476	missense	probably damaging	1.00
R4768:Shprh	UTSW	10	11181540	missense	probably damaging	0.96
R4867:Shprh	UTSW	10	11164557	missense	probably benign	0.00
R4937:Shprh	UTSW	10	11157119	missense	probably benign
R5140:Shprh	UTSW	10	11154705	missense	probably benign	0.03
R5318:Shprh	UTSW	10	11166557	missense	probably benign	0.04
R5323:Shprh	UTSW	10	11170297	splice site	probably null
R5450:Shprh	UTSW	10	11212330	missense	possibly damaging	0.70
R5872:Shprh	UTSW	10	11188073	missense	probably damaging	1.00
R6030:Shprh	UTSW	10	11151991	missense	probably benign	0.37
R6030:Shprh	UTSW	10	11151991	missense	probably benign	0.37
R6392:Shprh	UTSW	10	11178741	nonsense	probably null
R6416:Shprh	UTSW	10	11167873	missense	probably damaging	1.00
R6470:Shprh	UTSW	10	11171937	missense	probably damaging	0.98
R6513:Shprh	UTSW	10	11186893	missense	probably damaging	1.00
R6530:Shprh	UTSW	10	11194267	missense	probably benign	0.02
R6678:Shprh	UTSW	10	11166545	missense	probably benign	0.16
R6757:Shprh	UTSW	10	11181508	splice site	probably null
R6971:Shprh	UTSW	10	11166693	missense	probably damaging	1.00
R7158:Shprh	UTSW	10	11166730	missense	probably damaging	0.98
R7582:Shprh	UTSW	10	11164705	missense	probably benign
R7757:Shprh	UTSW	10	11162180	missense	probably benign	0.30
R7812:Shprh	UTSW	10	11151991	missense	probably benign
R7998:Shprh	UTSW	10	11185341	missense	probably damaging	1.00
R8061:Shprh	UTSW	10	11212333	missense	possibly damaging	0.71
R8082:Shprh	UTSW	10	11151811	missense	probably benign	0.22
R8116:Shprh	UTSW	10	11213461	missense	probably damaging	0.99
R8390:Shprh	UTSW	10	11187983	missense	possibly damaging	0.92
R8445:Shprh	UTSW	10	11181569	missense	possibly damaging	0.92
R8530:Shprh	UTSW	10	11151934	missense	probably benign	0.37
R8759:Shprh	UTSW	10	11157164	missense	possibly damaging	0.92
R8937:Shprh	UTSW	10	11185437	missense	possibly damaging	0.60
R8995:Shprh	UTSW	10	11164830	nonsense	probably null
R9053:Shprh	UTSW	10	11154702	missense	probably benign	0.04
R9131:Shprh	UTSW	10	11162845	missense	possibly damaging	0.58
R9176:Shprh	UTSW	10	11160576	missense	probably benign	0.02
R9391:Shprh	UTSW	10	11162889	missense	probably benign	0.05
R9423:Shprh	UTSW	10	11205263	missense	probably damaging	1.00
R9563:Shprh	UTSW	10	11166491	nonsense	probably null
R9668:Shprh	UTSW	10	11206332	missense	probably damaging	0.97
R9709:Shprh	UTSW	10	11162830	missense	possibly damaging	0.91
R9718:Shprh	UTSW	10	11213504	missense	probably damaging	1.00
R9750:Shprh	UTSW	10	11164460	missense	probably damaging	0.98
RF012:Shprh	UTSW	10	11164841	missense	probably benign	0.02
V8831:Shprh	UTSW	10	11186862	missense	probably damaging	1.00
Z1176:Shprh	UTSW	10	11164553	missense	probably benign
Z1176:Shprh	UTSW	10	11186447	missense	probably damaging	1.00
Z1177:Shprh	UTSW	10	11151762	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- CCAGCTCCTTGAAGAAAACTGAGCC -3'
(R):5'- TGTAACACGTCCCTCCTGATAAGCC -3'

Sequencing Primer
(F):5'- CTTAGGGGTGAGACCAATCCAG -3'
(R):5'- CTGATAAGCCCTTCTTTAAGCATC -3'

Posted On

2014-04-24