Incidental Mutation 'R1638:Shprh'
ID 173316
Institutional Source Beutler Lab
Gene Symbol Shprh
Ensembl Gene ENSMUSG00000090112
Gene Name SNF2 histone linker PHD RING helicase
Synonyms 2610103K11Rik, D230017O13Rik
MMRRC Submission 039674-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1638 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 11025171-11093339 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 11032822 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 269 (D269E)
Ref Sequence ENSEMBL: ENSMUSP00000125457 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044053] [ENSMUST00000054814] [ENSMUST00000159541] [ENSMUST00000159810]
AlphaFold Q7TPQ3
Predicted Effect probably benign
Transcript: ENSMUST00000044053
AA Change: D269E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000039422
Gene: ENSMUSG00000090112
AA Change: D269E

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Blast:DEXDc 195 250 3e-12 BLAST
low complexity region 253 265 N/A INTRINSIC
DEXDc 295 866 4.02e-17 SMART
H15 431 497 3.76e-5 SMART
PHD 651 698 2.33e-5 SMART
low complexity region 1393 1404 N/A INTRINSIC
RING 1423 1469 9.68e-3 SMART
Pfam:Helicase_C 1500 1613 1.6e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000054814
AA Change: D269E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000125849
Gene: ENSMUSG00000090112
AA Change: D269E

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Blast:DEXDc 195 250 3e-12 BLAST
low complexity region 253 265 N/A INTRINSIC
DEXDc 295 866 4.02e-17 SMART
H15 431 497 3.76e-5 SMART
PHD 651 698 2.33e-5 SMART
low complexity region 1393 1404 N/A INTRINSIC
RING 1423 1469 9.68e-3 SMART
SCOP:d1fuka_ 1504 1616 6e-8 SMART
Blast:HELICc 1533 1613 4e-46 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000159541
AA Change: D269E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000132870
Gene: ENSMUSG00000090112
AA Change: D269E

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Blast:DEXDc 195 250 3e-12 BLAST
low complexity region 253 265 N/A INTRINSIC
DEXDc 295 866 4.02e-17 SMART
H15 431 497 3.76e-5 SMART
PHD 651 698 2.33e-5 SMART
low complexity region 1393 1404 N/A INTRINSIC
RING 1423 1469 9.68e-3 SMART
SCOP:d1fuka_ 1504 1619 4e-8 SMART
Blast:HELICc 1533 1613 6e-46 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000159810
AA Change: D269E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000125457
Gene: ENSMUSG00000090112
AA Change: D269E

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Blast:DEXDc 195 250 2e-12 BLAST
low complexity region 253 265 N/A INTRINSIC
DEXDc 295 866 4.02e-17 SMART
H15 431 497 3.76e-5 SMART
PHD 651 698 2.33e-5 SMART
Blast:DEXDc 948 1026 2e-9 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161858
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 94.9%
  • 20x: 87.8%
Validation Efficiency 99% (79/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SHPRH is a ubiquitously expressed protein that contains motifs characteristics of several DNA repair proteins, transcription factors, and helicases. SHPRH is a functional homolog of S. cerevisiae RAD5 (Unk et al., 2006 [PubMed 17108083]).[supplied by OMIM, Mar 2008]
PHENOTYPE: The gene product is an E3 ligase involved in poly-ubiquitination of Pcna. Neither homozygous truncation nor KO affect B cell somatic hypermutation or class switching. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m C A 6: 121,631,571 (GRCm39) L623M probably benign Het
Adamts13 A G 2: 26,886,595 (GRCm39) E938G possibly damaging Het
Agfg1 A T 1: 82,871,259 (GRCm39) Q497L probably damaging Het
Ahnak A G 19: 8,986,813 (GRCm39) H2699R probably benign Het
Antxrl G T 14: 33,792,453 (GRCm39) probably null Het
Apol7c A T 15: 77,410,418 (GRCm39) V176E probably damaging Het
Arid5b T C 10: 68,113,777 (GRCm39) N87D possibly damaging Het
Atp2c1 A T 9: 105,309,897 (GRCm39) I560N probably damaging Het
Atp2c2 T C 8: 120,482,742 (GRCm39) F868S possibly damaging Het
Blnk G C 19: 40,926,122 (GRCm39) F326L probably benign Het
Bltp1 C T 3: 37,089,961 (GRCm39) R4130* probably null Het
Ckap2 C T 8: 22,665,812 (GRCm39) V412I possibly damaging Het
Clmn A G 12: 104,748,281 (GRCm39) V422A probably benign Het
Ctnnal1 A G 4: 56,813,856 (GRCm39) S638P probably benign Het
Cyp2j5 T C 4: 96,524,052 (GRCm39) S327G probably benign Het
Dhx38 G A 8: 110,280,177 (GRCm39) T871M probably damaging Het
Dmxl1 A T 18: 50,023,834 (GRCm39) K1706* probably null Het
Dnah11 A G 12: 117,979,154 (GRCm39) L2648P possibly damaging Het
Elf2 G A 3: 51,215,530 (GRCm39) T60I probably damaging Het
Fam120b T A 17: 15,622,759 (GRCm39) C246S possibly damaging Het
Fcho2 G T 13: 98,882,403 (GRCm39) T451K possibly damaging Het
Fzd9 T A 5: 135,278,602 (GRCm39) I428F probably damaging Het
Galnt13 T A 2: 54,744,667 (GRCm39) V122E probably damaging Het
Gm21738 T A 14: 19,418,908 (GRCm38) Y8F probably benign Het
Gnptab A G 10: 88,272,029 (GRCm39) I940V possibly damaging Het
Gp2 A G 7: 119,050,721 (GRCm39) probably null Het
Gpr6 A G 10: 40,946,530 (GRCm39) S351P probably benign Het
Gprin1 T C 13: 54,887,689 (GRCm39) E195G possibly damaging Het
Grm8 A T 6: 28,125,882 (GRCm39) Y81* probably null Het
Gtf3c3 A T 1: 54,444,278 (GRCm39) N703K probably damaging Het
Hhipl2 G A 1: 183,208,921 (GRCm39) V495I probably benign Het
Islr G A 9: 58,065,502 (GRCm39) probably benign Het
Lrrc36 T C 8: 106,176,273 (GRCm39) Y216H possibly damaging Het
Macroh2a1 T A 13: 56,252,722 (GRCm39) N87Y probably damaging Het
Me2 A G 18: 73,906,205 (GRCm39) I528T probably benign Het
Mecr A T 4: 131,585,127 (GRCm39) I156F possibly damaging Het
Megf6 A G 4: 154,346,967 (GRCm39) probably benign Het
Mn1 T A 5: 111,569,435 (GRCm39) L1135H probably damaging Het
Naip5 A G 13: 100,349,177 (GRCm39) S1384P probably damaging Het
Nav2 A G 7: 49,102,213 (GRCm39) N337S probably benign Het
Ndn C T 7: 61,998,256 (GRCm39) P34L probably benign Het
Neb A T 2: 52,139,293 (GRCm39) H3107Q probably benign Het
Nebl A G 2: 17,381,462 (GRCm39) V738A possibly damaging Het
Nsd2 G A 5: 34,039,464 (GRCm39) R825Q possibly damaging Het
Nsun2 A G 13: 69,775,705 (GRCm39) N383S probably damaging Het
Ntrk3 A T 7: 77,897,036 (GRCm39) M667K probably damaging Het
Or10a48 A C 7: 108,424,442 (GRCm39) C255G probably benign Het
Or11h6 G A 14: 50,880,565 (GRCm39) V276M possibly damaging Het
Or1e29 A G 11: 73,667,974 (GRCm39) Y60H possibly damaging Het
Or6c2 A T 10: 129,362,488 (GRCm39) M131L probably benign Het
Pex6 T C 17: 47,033,558 (GRCm39) V633A probably benign Het
Phactr1 C T 13: 43,110,147 (GRCm39) T95M probably damaging Het
Pik3r4 A G 9: 105,564,408 (GRCm39) D1334G probably damaging Het
Pkhd1l1 A C 15: 44,460,513 (GRCm39) I4241L probably benign Het
Ppwd1 T C 13: 104,356,771 (GRCm39) E248G probably damaging Het
Prepl A C 17: 85,379,509 (GRCm39) M393R probably benign Het
Ptpn6 T C 6: 124,698,148 (GRCm39) S532G probably benign Het
Rnase11 G T 14: 51,287,058 (GRCm39) H165Q possibly damaging Het
Sf1 A G 19: 6,422,090 (GRCm39) N172S possibly damaging Het
Slc16a1 T C 3: 104,556,798 (GRCm39) I61T possibly damaging Het
Slc38a2 A C 15: 96,590,417 (GRCm39) I309S probably damaging Het
Sry C G Y: 2,663,149 (GRCm39) Q170H unknown Het
Stk3 A C 15: 35,008,454 (GRCm39) probably null Het
Tg C A 15: 66,568,015 (GRCm39) C1306* probably null Het
Tnik A G 3: 28,719,889 (GRCm39) M1254V probably damaging Het
U2surp T C 9: 95,366,280 (GRCm39) E474G possibly damaging Het
Vmn1r224 T A 17: 20,639,587 (GRCm39) F55I probably benign Het
Vmn1r32 A G 6: 66,529,939 (GRCm39) I279T possibly damaging Het
Zc2hc1a A G 3: 7,581,543 (GRCm39) D15G probably benign Het
Zfp827 C A 8: 79,802,975 (GRCm39) P516T possibly damaging Het
Zfyve9 A T 4: 108,542,104 (GRCm39) probably null Het
Other mutations in Shprh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Shprh APN 10 11,063,902 (GRCm39) missense probably damaging 1.00
IGL00583:Shprh APN 10 11,063,764 (GRCm39) missense probably benign 0.37
IGL00684:Shprh APN 10 11,038,781 (GRCm39) missense probably benign 0.11
IGL01295:Shprh APN 10 11,059,612 (GRCm39) missense probably damaging 0.96
IGL01387:Shprh APN 10 11,045,998 (GRCm39) missense probably damaging 1.00
IGL01635:Shprh APN 10 11,045,763 (GRCm39) nonsense probably null
IGL01833:Shprh APN 10 11,066,806 (GRCm39) missense probably damaging 1.00
IGL02013:Shprh APN 10 11,057,246 (GRCm39) splice site probably benign
IGL02502:Shprh APN 10 11,070,101 (GRCm39) missense possibly damaging 0.66
IGL02819:Shprh APN 10 11,030,509 (GRCm39) missense possibly damaging 0.93
PIT4581001:Shprh UTSW 10 11,068,238 (GRCm39) frame shift probably null
R0010:Shprh UTSW 10 11,027,675 (GRCm39) missense probably benign
R0010:Shprh UTSW 10 11,027,675 (GRCm39) missense probably benign
R0053:Shprh UTSW 10 11,070,116 (GRCm39) splice site probably null
R0053:Shprh UTSW 10 11,070,116 (GRCm39) splice site probably null
R0255:Shprh UTSW 10 11,062,135 (GRCm39) missense possibly damaging 0.92
R0325:Shprh UTSW 10 11,045,853 (GRCm39) missense probably benign 0.00
R0331:Shprh UTSW 10 11,069,914 (GRCm39) splice site probably benign
R0494:Shprh UTSW 10 11,032,935 (GRCm39) missense probably damaging 1.00
R0532:Shprh UTSW 10 11,038,556 (GRCm39) missense possibly damaging 0.90
R0546:Shprh UTSW 10 11,059,631 (GRCm39) splice site probably benign
R0574:Shprh UTSW 10 11,038,821 (GRCm39) unclassified probably benign
R0605:Shprh UTSW 10 11,082,856 (GRCm39) missense probably damaging 1.00
R0662:Shprh UTSW 10 11,062,591 (GRCm39) missense probably damaging 1.00
R1148:Shprh UTSW 10 11,089,226 (GRCm39) missense possibly damaging 0.95
R1148:Shprh UTSW 10 11,089,226 (GRCm39) missense possibly damaging 0.95
R1263:Shprh UTSW 10 11,035,274 (GRCm39) missense probably damaging 1.00
R1588:Shprh UTSW 10 11,040,488 (GRCm39) missense probably damaging 1.00
R1830:Shprh UTSW 10 11,062,655 (GRCm39) splice site probably null
R1898:Shprh UTSW 10 11,062,613 (GRCm39) missense probably damaging 1.00
R1903:Shprh UTSW 10 11,059,541 (GRCm39) nonsense probably null
R2060:Shprh UTSW 10 11,027,864 (GRCm39) missense probably benign 0.03
R2225:Shprh UTSW 10 11,037,979 (GRCm39) unclassified probably benign
R2363:Shprh UTSW 10 11,047,697 (GRCm39) missense probably damaging 1.00
R2509:Shprh UTSW 10 11,042,468 (GRCm39) missense probably damaging 1.00
R2891:Shprh UTSW 10 11,040,100 (GRCm39) missense probably damaging 1.00
R3077:Shprh UTSW 10 11,046,157 (GRCm39) missense probably damaging 1.00
R3150:Shprh UTSW 10 11,045,774 (GRCm39) missense probably damaging 0.97
R3796:Shprh UTSW 10 11,054,501 (GRCm39) missense possibly damaging 0.89
R4196:Shprh UTSW 10 11,083,604 (GRCm39) utr 3 prime probably benign
R4423:Shprh UTSW 10 11,062,262 (GRCm39) missense possibly damaging 0.82
R4488:Shprh UTSW 10 11,036,215 (GRCm39) missense probably benign 0.17
R4748:Shprh UTSW 10 11,046,220 (GRCm39) missense probably damaging 1.00
R4768:Shprh UTSW 10 11,057,284 (GRCm39) missense probably damaging 0.96
R4867:Shprh UTSW 10 11,040,301 (GRCm39) missense probably benign 0.00
R4937:Shprh UTSW 10 11,032,863 (GRCm39) missense probably benign
R5140:Shprh UTSW 10 11,030,449 (GRCm39) missense probably benign 0.03
R5318:Shprh UTSW 10 11,042,301 (GRCm39) missense probably benign 0.04
R5323:Shprh UTSW 10 11,046,041 (GRCm39) splice site probably null
R5450:Shprh UTSW 10 11,088,074 (GRCm39) missense possibly damaging 0.70
R5872:Shprh UTSW 10 11,063,817 (GRCm39) missense probably damaging 1.00
R6030:Shprh UTSW 10 11,027,735 (GRCm39) missense probably benign 0.37
R6030:Shprh UTSW 10 11,027,735 (GRCm39) missense probably benign 0.37
R6392:Shprh UTSW 10 11,054,485 (GRCm39) nonsense probably null
R6416:Shprh UTSW 10 11,043,617 (GRCm39) missense probably damaging 1.00
R6470:Shprh UTSW 10 11,047,681 (GRCm39) missense probably damaging 0.98
R6513:Shprh UTSW 10 11,062,637 (GRCm39) missense probably damaging 1.00
R6530:Shprh UTSW 10 11,070,011 (GRCm39) missense probably benign 0.02
R6678:Shprh UTSW 10 11,042,289 (GRCm39) missense probably benign 0.16
R6757:Shprh UTSW 10 11,057,252 (GRCm39) splice site probably null
R6971:Shprh UTSW 10 11,042,437 (GRCm39) missense probably damaging 1.00
R7158:Shprh UTSW 10 11,042,474 (GRCm39) missense probably damaging 0.98
R7582:Shprh UTSW 10 11,040,449 (GRCm39) missense probably benign
R7757:Shprh UTSW 10 11,037,924 (GRCm39) missense probably benign 0.30
R7812:Shprh UTSW 10 11,027,735 (GRCm39) missense probably benign
R7998:Shprh UTSW 10 11,061,085 (GRCm39) missense probably damaging 1.00
R8061:Shprh UTSW 10 11,088,077 (GRCm39) missense possibly damaging 0.71
R8082:Shprh UTSW 10 11,027,555 (GRCm39) missense probably benign 0.22
R8116:Shprh UTSW 10 11,089,205 (GRCm39) missense probably damaging 0.99
R8390:Shprh UTSW 10 11,063,727 (GRCm39) missense possibly damaging 0.92
R8445:Shprh UTSW 10 11,057,313 (GRCm39) missense possibly damaging 0.92
R8530:Shprh UTSW 10 11,027,678 (GRCm39) missense probably benign 0.37
R8759:Shprh UTSW 10 11,032,908 (GRCm39) missense possibly damaging 0.92
R8937:Shprh UTSW 10 11,061,181 (GRCm39) missense possibly damaging 0.60
R8995:Shprh UTSW 10 11,040,574 (GRCm39) nonsense probably null
R9053:Shprh UTSW 10 11,030,446 (GRCm39) missense probably benign 0.04
R9131:Shprh UTSW 10 11,038,589 (GRCm39) missense possibly damaging 0.58
R9176:Shprh UTSW 10 11,036,320 (GRCm39) missense probably benign 0.02
R9391:Shprh UTSW 10 11,038,633 (GRCm39) missense probably benign 0.05
R9423:Shprh UTSW 10 11,081,007 (GRCm39) missense probably damaging 1.00
R9563:Shprh UTSW 10 11,042,235 (GRCm39) nonsense probably null
R9668:Shprh UTSW 10 11,082,076 (GRCm39) missense probably damaging 0.97
R9709:Shprh UTSW 10 11,038,574 (GRCm39) missense possibly damaging 0.91
R9718:Shprh UTSW 10 11,089,248 (GRCm39) missense probably damaging 1.00
R9750:Shprh UTSW 10 11,040,204 (GRCm39) missense probably damaging 0.98
RF012:Shprh UTSW 10 11,040,585 (GRCm39) missense probably benign 0.02
V8831:Shprh UTSW 10 11,062,606 (GRCm39) missense probably damaging 1.00
Z1176:Shprh UTSW 10 11,062,191 (GRCm39) missense probably damaging 1.00
Z1176:Shprh UTSW 10 11,040,297 (GRCm39) missense probably benign
Z1177:Shprh UTSW 10 11,027,506 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- CCAGCTCCTTGAAGAAAACTGAGCC -3'
(R):5'- TGTAACACGTCCCTCCTGATAAGCC -3'

Sequencing Primer
(F):5'- CTTAGGGGTGAGACCAATCCAG -3'
(R):5'- CTGATAAGCCCTTCTTTAAGCATC -3'
Posted On 2014-04-24