Mutagenetix > Incidental Mutation

Incidental Mutation 'R1638:Olfr389'

173321

Institutional Source

Beutler Lab

Gene Symbol

Olfr389

Ensembl Gene

ENSMUSG00000070383

Gene Name

olfactory receptor 389

Synonyms

MOR135-6, GA_x6K02T2P1NL-3932085-3931147

MMRRC Submission

039674-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.052) question?

Stock #

R1638 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

73774849-73780713 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 73777148 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 60 (Y60H)

Ref Sequence

ENSEMBL: ENSMUSP00000149734 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000122224] [ENSMUST00000124927] [ENSMUST00000215418]

AlphaFold

Q7TRX7

Predicted Effect

possibly damaging
Transcript: ENSMUST00000122224
AA Change: Y60H

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000113364
Gene: ENSMUSG00000070383
AA Change: Y60H

Domain	Start	End	E-Value	Type
Pfam:7tm_4	31	308	2.8e-56	PFAM
Pfam:7TM_GPCR_Srsx	35	305	4.2e-6	PFAM
Pfam:7tm_1	41	290	2e-25	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000124927
AA Change: Y60H

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000115639
Gene: ENSMUSG00000070383
AA Change: Y60H

Domain	Start	End	E-Value	Type
Pfam:7TM_GPCR_Srsx	35	221	6.6e-7	PFAM
Pfam:7tm_1	41	224	3.5e-29	PFAM
Pfam:7tm_4	139	224	1.4e-20	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000215418
AA Change: Y60H

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)

Meta Mutation Damage Score

0.2118

Coding Region Coverage

1x: 99.0%
3x: 97.9%
10x: 94.9%
20x: 87.8%

Validation Efficiency

99% (79/80)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	C	T	3: 37,035,812	R4130*	probably null	Het
A2m	C	A	6: 121,654,612	L623M	probably benign	Het
Adamts13	A	G	2: 26,996,583	E938G	possibly damaging	Het
Agfg1	A	T	1: 82,893,538	Q497L	probably damaging	Het
Ahnak	A	G	19: 9,009,449	H2699R	probably benign	Het
Antxrl	G	T	14: 34,070,496		probably null	Het
Apol7c	A	T	15: 77,526,218	V176E	probably damaging	Het
Arid5b	T	C	10: 68,277,947	N87D	possibly damaging	Het
Atp2c1	A	T	9: 105,432,698	I560N	probably damaging	Het
Atp2c2	T	C	8: 119,756,003	F868S	possibly damaging	Het
Blnk	G	C	19: 40,937,678	F326L	probably benign	Het
Ckap2	C	T	8: 22,175,796	V412I	possibly damaging	Het
Clmn	A	G	12: 104,782,022	V422A	probably benign	Het
Ctnnal1	A	G	4: 56,813,856	S638P	probably benign	Het
Cyp2j5	T	C	4: 96,635,815	S327G	probably benign	Het
Dhx38	G	A	8: 109,553,545	T871M	probably damaging	Het
Dmxl1	A	T	18: 49,890,767	K1706*	probably null	Het
Dnah11	A	G	12: 118,015,419	L2648P	possibly damaging	Het
Elf2	G	A	3: 51,308,109	T60I	probably damaging	Het
Fam120b	T	A	17: 15,402,497	C246S	possibly damaging	Het
Fcho2	G	T	13: 98,745,895	T451K	possibly damaging	Het
Fzd9	T	A	5: 135,249,748	I428F	probably damaging	Het
Galnt13	T	A	2: 54,854,655	V122E	probably damaging	Het
Gm21738	T	A	14: 19,418,908	Y8F	probably benign	Het
Gnptab	A	G	10: 88,436,167	I940V	possibly damaging	Het
Gp2	A	G	7: 119,451,498		probably null	Het
Gpr6	A	G	10: 41,070,534	S351P	probably benign	Het
Gprin1	T	C	13: 54,739,876	E195G	possibly damaging	Het
Grm8	A	T	6: 28,125,883	Y81*	probably null	Het
Gtf3c3	A	T	1: 54,405,119	N703K	probably damaging	Het
H2afy	T	A	13: 56,104,909	N87Y	probably damaging	Het
Hhipl2	G	A	1: 183,428,013	V495I	probably benign	Het
Islr	G	A	9: 58,158,219		probably benign	Het
Lrrc36	T	C	8: 105,449,641	Y216H	possibly damaging	Het
Me2	A	G	18: 73,773,134	I528T	probably benign	Het
Mecr	A	T	4: 131,857,816	I156F	possibly damaging	Het
Megf6	A	G	4: 154,262,510		probably benign	Het
Mn1	T	A	5: 111,421,569	L1135H	probably damaging	Het
Naip5	A	G	13: 100,212,669	S1384P	probably damaging	Het
Nav2	A	G	7: 49,452,465	N337S	probably benign	Het
Ndn	C	T	7: 62,348,508	P34L	probably benign	Het
Neb	A	T	2: 52,249,281	H3107Q	probably benign	Het
Nebl	A	G	2: 17,376,651	V738A	possibly damaging	Het
Nsd2	G	A	5: 33,882,120	R825Q	possibly damaging	Het
Nsun2	A	G	13: 69,627,586	N383S	probably damaging	Het
Ntrk3	A	T	7: 78,247,288	M667K	probably damaging	Het
Olfr514	A	C	7: 108,825,235	C255G	probably benign	Het
Olfr745	G	A	14: 50,643,108	V276M	possibly damaging	Het
Olfr791	A	T	10: 129,526,619	M131L	probably benign	Het
Pex6	T	C	17: 46,722,632	V633A	probably benign	Het
Phactr1	C	T	13: 42,956,671	T95M	probably damaging	Het
Pik3r4	A	G	9: 105,687,209	D1334G	probably damaging	Het
Pkhd1l1	A	C	15: 44,597,117	I4241L	probably benign	Het
Ppwd1	T	C	13: 104,220,263	E248G	probably damaging	Het
Prepl	A	C	17: 85,072,081	M393R	probably benign	Het
Ptpn6	T	C	6: 124,721,185	S532G	probably benign	Het
Rnase11	G	T	14: 51,049,601	H165Q	possibly damaging	Het
Sf1	A	G	19: 6,372,060	N172S	possibly damaging	Het
Shprh	T	A	10: 11,157,078	D269E	probably benign	Het
Slc16a1	T	C	3: 104,649,482	I61T	possibly damaging	Het
Slc38a2	A	C	15: 96,692,536	I309S	probably damaging	Het
Sry	C	G	Y: 2,663,149	Q170H	unknown	Het
Stk3	A	C	15: 35,008,308		probably null	Het
Tg	C	A	15: 66,696,166	C1306*	probably null	Het
Tnik	A	G	3: 28,665,740	M1254V	probably damaging	Het
U2surp	T	C	9: 95,484,227	E474G	possibly damaging	Het
Vmn1r224	T	A	17: 20,419,325	F55I	probably benign	Het
Vmn1r32	A	G	6: 66,552,955	I279T	possibly damaging	Het
Zc2hc1a	A	G	3: 7,516,483	D15G	probably benign	Het
Zfp827	C	A	8: 79,076,346	P516T	possibly damaging	Het
Zfyve9	A	T	4: 108,684,907		probably null	Het

Other mutations in Olfr389

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01458:Olfr389	APN	11	73776706	missense	probably benign	0.44
IGL01766:Olfr389	APN	11	73777075	missense	probably benign	0.41
IGL01771:Olfr389	APN	11	73776664	missense	probably damaging	1.00
IGL02535:Olfr389	APN	11	73776616	missense	probably benign	0.00
IGL02639:Olfr389	APN	11	73776545	missense	probably benign	0.21
IGL03060:Olfr389	APN	11	73776463	missense	probably damaging	1.00
IGL03075:Olfr389	APN	11	73776472	missense	probably damaging	1.00
R0081:Olfr389	UTSW	11	73777109	missense	possibly damaging	0.59
R0426:Olfr389	UTSW	11	73776437	missense	probably benign	0.13
R1140:Olfr389	UTSW	11	73776854	missense	probably benign
R2001:Olfr389	UTSW	11	73776713	missense	probably benign
R2214:Olfr389	UTSW	11	73776829	nonsense	probably null
R3076:Olfr389	UTSW	11	73776640	missense	possibly damaging	0.93
R3077:Olfr389	UTSW	11	73776640	missense	possibly damaging	0.93
R3078:Olfr389	UTSW	11	73776640	missense	possibly damaging	0.93
R3081:Olfr389	UTSW	11	73777225	missense	probably damaging	1.00
R3430:Olfr389	UTSW	11	73776539	missense	probably damaging	1.00
R3731:Olfr389	UTSW	11	73776739	missense	probably benign	0.08
R4090:Olfr389	UTSW	11	73776841	missense	probably damaging	1.00
R4303:Olfr389	UTSW	11	73776838	missense	possibly damaging	0.78
R4516:Olfr389	UTSW	11	73777040	missense	probably benign	0.06
R4556:Olfr389	UTSW	11	73776481	missense	possibly damaging	0.65
R4557:Olfr389	UTSW	11	73776481	missense	possibly damaging	0.65
R4775:Olfr389	UTSW	11	73776551	missense	probably damaging	1.00
R4858:Olfr389	UTSW	11	73776546	missense	probably benign	0.44
R5015:Olfr389	UTSW	11	73777181	missense	probably benign	0.07
R5087:Olfr389	UTSW	11	73777258	missense	possibly damaging	0.75
R6599:Olfr389	UTSW	11	73776680	missense	probably benign
R6701:Olfr389	UTSW	11	73776470	missense	probably damaging	1.00
R6784:Olfr389	UTSW	11	73776850	missense	probably damaging	1.00
R6916:Olfr389	UTSW	11	73777069	missense	probably benign	0.00
R7066:Olfr389	UTSW	11	73777192	missense	probably damaging	0.99
R7226:Olfr389	UTSW	11	73776677	missense	possibly damaging	0.95
R7457:Olfr389	UTSW	11	73776826	missense	probably benign	0.06
R7486:Olfr389	UTSW	11	73777021	missense	probably damaging	1.00
R7990:Olfr389	UTSW	11	73776671	missense	probably benign	0.00
R8289:Olfr389	UTSW	11	73777013	missense	probably benign
R9131:Olfr389	UTSW	11	73777324	start codon destroyed	probably null	1.00
R9160:Olfr389	UTSW	11	73777055	missense	probably benign	0.01
R9239:Olfr389	UTSW	11	73776520	missense	probably benign	0.00
R9666:Olfr389	UTSW	11	73777150	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATGTTGTCAGCATCCACAGTAGTAGC -3'
(R):5'- CCTTGTGTGTCACAAACCACATCCC -3'

Sequencing Primer
(F):5'- CAGAACTTGGTACTCATGATGCTG -3'
(R):5'- TGGTCTATGATATACAGGCACAACC -3'

Posted On

2014-04-24