Incidental Mutation 'R1638:Nsun2'
ID 173327
Institutional Source Beutler Lab
Gene Symbol Nsun2
Ensembl Gene ENSMUSG00000021595
Gene Name NOL1/NOP2/Sun domain family member 2
Synonyms Misu
MMRRC Submission 039674-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.916) question?
Stock # R1638 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 69533746-69635780 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 69627586 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 383 (N383S)
Ref Sequence ENSEMBL: ENSMUSP00000135455 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022087] [ENSMUST00000109699] [ENSMUST00000176485]
AlphaFold Q1HFZ0
Predicted Effect possibly damaging
Transcript: ENSMUST00000022087
AA Change: N352S

PolyPhen 2 Score 0.898 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000022087
Gene: ENSMUSG00000021595
AA Change: N352S

DomainStartEndE-ValueType
Pfam:Nol1_Nop2_Fmu 83 209 4.5e-19 PFAM
Pfam:Nol1_Nop2_Fmu 199 376 1.1e-23 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000109699
AA Change: N418S

PolyPhen 2 Score 0.898 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000105321
Gene: ENSMUSG00000021595
AA Change: N418S

DomainStartEndE-ValueType
Pfam:Nol1_Nop2_Fmu 169 428 3.2e-40 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136891
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136932
Predicted Effect probably damaging
Transcript: ENSMUST00000176485
AA Change: N383S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000135455
Gene: ENSMUSG00000021595
AA Change: N383S

DomainStartEndE-ValueType
Pfam:Nol1_Nop2_Fmu 114 240 3.5e-19 PFAM
Pfam:Nol1_Nop2_Fmu 230 399 1.1e-23 PFAM
Meta Mutation Damage Score 0.2270 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 94.9%
  • 20x: 87.8%
Validation Efficiency 99% (79/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a methyltransferase that catalyzes the methylation of cytosine to 5-methylcytosine (m5C) at position 34 of intron-containing tRNA(Leu)(CAA) precursors. This modification is necessary to stabilize the anticodon-codon pairing and correctly translate the mRNA. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene.[provided by RefSeq, Mar 2011]
PHENOTYPE: Homozygous inactivation of this gene leads to decreased body size, male sterility, and hair cycle anomalies. Additional phenotypes may include reduced body fat, skeletal, craniofacial and eye defects, abnormal erythropoiesis, and altered energy expenditure and gas, glucose, and lipid homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik C T 3: 37,035,812 R4130* probably null Het
A2m C A 6: 121,654,612 L623M probably benign Het
Adamts13 A G 2: 26,996,583 E938G possibly damaging Het
Agfg1 A T 1: 82,893,538 Q497L probably damaging Het
Ahnak A G 19: 9,009,449 H2699R probably benign Het
Antxrl G T 14: 34,070,496 probably null Het
Apol7c A T 15: 77,526,218 V176E probably damaging Het
Arid5b T C 10: 68,277,947 N87D possibly damaging Het
Atp2c1 A T 9: 105,432,698 I560N probably damaging Het
Atp2c2 T C 8: 119,756,003 F868S possibly damaging Het
Blnk G C 19: 40,937,678 F326L probably benign Het
Ckap2 C T 8: 22,175,796 V412I possibly damaging Het
Clmn A G 12: 104,782,022 V422A probably benign Het
Ctnnal1 A G 4: 56,813,856 S638P probably benign Het
Cyp2j5 T C 4: 96,635,815 S327G probably benign Het
Dhx38 G A 8: 109,553,545 T871M probably damaging Het
Dmxl1 A T 18: 49,890,767 K1706* probably null Het
Dnah11 A G 12: 118,015,419 L2648P possibly damaging Het
Elf2 G A 3: 51,308,109 T60I probably damaging Het
Fam120b T A 17: 15,402,497 C246S possibly damaging Het
Fcho2 G T 13: 98,745,895 T451K possibly damaging Het
Fzd9 T A 5: 135,249,748 I428F probably damaging Het
Galnt13 T A 2: 54,854,655 V122E probably damaging Het
Gm21738 T A 14: 19,418,908 Y8F probably benign Het
Gnptab A G 10: 88,436,167 I940V possibly damaging Het
Gp2 A G 7: 119,451,498 probably null Het
Gpr6 A G 10: 41,070,534 S351P probably benign Het
Gprin1 T C 13: 54,739,876 E195G possibly damaging Het
Grm8 A T 6: 28,125,883 Y81* probably null Het
Gtf3c3 A T 1: 54,405,119 N703K probably damaging Het
H2afy T A 13: 56,104,909 N87Y probably damaging Het
Hhipl2 G A 1: 183,428,013 V495I probably benign Het
Islr G A 9: 58,158,219 probably benign Het
Lrrc36 T C 8: 105,449,641 Y216H possibly damaging Het
Me2 A G 18: 73,773,134 I528T probably benign Het
Mecr A T 4: 131,857,816 I156F possibly damaging Het
Megf6 A G 4: 154,262,510 probably benign Het
Mn1 T A 5: 111,421,569 L1135H probably damaging Het
Naip5 A G 13: 100,212,669 S1384P probably damaging Het
Nav2 A G 7: 49,452,465 N337S probably benign Het
Ndn C T 7: 62,348,508 P34L probably benign Het
Neb A T 2: 52,249,281 H3107Q probably benign Het
Nebl A G 2: 17,376,651 V738A possibly damaging Het
Nsd2 G A 5: 33,882,120 R825Q possibly damaging Het
Ntrk3 A T 7: 78,247,288 M667K probably damaging Het
Olfr389 A G 11: 73,777,148 Y60H possibly damaging Het
Olfr514 A C 7: 108,825,235 C255G probably benign Het
Olfr745 G A 14: 50,643,108 V276M possibly damaging Het
Olfr791 A T 10: 129,526,619 M131L probably benign Het
Pex6 T C 17: 46,722,632 V633A probably benign Het
Phactr1 C T 13: 42,956,671 T95M probably damaging Het
Pik3r4 A G 9: 105,687,209 D1334G probably damaging Het
Pkhd1l1 A C 15: 44,597,117 I4241L probably benign Het
Ppwd1 T C 13: 104,220,263 E248G probably damaging Het
Prepl A C 17: 85,072,081 M393R probably benign Het
Ptpn6 T C 6: 124,721,185 S532G probably benign Het
Rnase11 G T 14: 51,049,601 H165Q possibly damaging Het
Sf1 A G 19: 6,372,060 N172S possibly damaging Het
Shprh T A 10: 11,157,078 D269E probably benign Het
Slc16a1 T C 3: 104,649,482 I61T possibly damaging Het
Slc38a2 A C 15: 96,692,536 I309S probably damaging Het
Sry C G Y: 2,663,149 Q170H unknown Het
Stk3 A C 15: 35,008,308 probably null Het
Tg C A 15: 66,696,166 C1306* probably null Het
Tnik A G 3: 28,665,740 M1254V probably damaging Het
U2surp T C 9: 95,484,227 E474G possibly damaging Het
Vmn1r224 T A 17: 20,419,325 F55I probably benign Het
Vmn1r32 A G 6: 66,552,955 I279T possibly damaging Het
Zc2hc1a A G 3: 7,516,483 D15G probably benign Het
Zfp827 C A 8: 79,076,346 P516T possibly damaging Het
Zfyve9 A T 4: 108,684,907 probably null Het
Other mutations in Nsun2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01660:Nsun2 APN 13 69623249 missense probably benign 0.01
IGL01997:Nsun2 APN 13 69623246 missense probably damaging 1.00
IGL02253:Nsun2 APN 13 69619539 missense possibly damaging 0.88
IGL03038:Nsun2 APN 13 69619584 missense probably damaging 1.00
IGL02984:Nsun2 UTSW 13 69543608 intron probably benign
PIT4494001:Nsun2 UTSW 13 69618192 critical splice donor site probably null
R0601:Nsun2 UTSW 13 69633242 missense probably benign 0.40
R0648:Nsun2 UTSW 13 69627587 missense probably damaging 1.00
R0690:Nsun2 UTSW 13 69629542 missense probably benign
R0718:Nsun2 UTSW 13 69543697 intron probably benign
R1501:Nsun2 UTSW 13 69631587 missense probably damaging 1.00
R1678:Nsun2 UTSW 13 69627103 missense probably damaging 1.00
R1687:Nsun2 UTSW 13 69627597 missense probably damaging 1.00
R2327:Nsun2 UTSW 13 69619581 missense probably benign 0.44
R2872:Nsun2 UTSW 13 69629682 missense probably damaging 1.00
R2872:Nsun2 UTSW 13 69629682 missense probably damaging 1.00
R3689:Nsun2 UTSW 13 69612337 missense probably damaging 1.00
R3691:Nsun2 UTSW 13 69612337 missense probably damaging 1.00
R3739:Nsun2 UTSW 13 69629638 missense probably benign
R3918:Nsun2 UTSW 13 69630680 missense probably damaging 1.00
R4065:Nsun2 UTSW 13 69612460 critical splice donor site probably null
R4231:Nsun2 UTSW 13 69619541 missense probably damaging 1.00
R4445:Nsun2 UTSW 13 69629721 splice site probably null
R4872:Nsun2 UTSW 13 69543873 intron probably benign
R5641:Nsun2 UTSW 13 69623249 missense probably benign 0.01
R5718:Nsun2 UTSW 13 69623284 missense probably benign 0.19
R5976:Nsun2 UTSW 13 69623152 splice site probably null
R6110:Nsun2 UTSW 13 69627648 missense probably benign 0.01
R6943:Nsun2 UTSW 13 69630033 missense probably damaging 1.00
R6968:Nsun2 UTSW 13 69631290 missense probably benign 0.00
R7146:Nsun2 UTSW 13 69626553 critical splice donor site probably null
R7456:Nsun2 UTSW 13 69633606 missense probably damaging 0.98
R8017:Nsun2 UTSW 13 69627645 missense probably damaging 0.99
R8019:Nsun2 UTSW 13 69627645 missense probably damaging 0.99
R8225:Nsun2 UTSW 13 69612374 missense possibly damaging 0.93
R8935:Nsun2 UTSW 13 69619467 missense probably damaging 1.00
X0064:Nsun2 UTSW 13 69615519 critical splice donor site probably null
Z1088:Nsun2 UTSW 13 69615465 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTCCATAAATGCCTGTAGTGTGCC -3'
(R):5'- GCTCAAGAGCTTCGTAACACCCTC -3'

Sequencing Primer
(F):5'- CTGTAGTGTGCCTTGATGATCAC -3'
(R):5'- CAGCTCTCAAAACCTTCACTTGG -3'
Posted On 2014-04-24