Incidental Mutation 'R1638:Ppwd1'
ID173330
Institutional Source Beutler Lab
Gene Symbol Ppwd1
Ensembl Gene ENSMUSG00000021713
Gene Namepeptidylprolyl isomerase domain and WD repeat containing 1
Synonyms4632422M10Rik, A330090G21Rik
MMRRC Submission 039674-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock #R1638 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location104205124-104228843 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 104220263 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 248 (E248G)
Ref Sequence ENSEMBL: ENSMUSP00000022226 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022226]
Predicted Effect probably damaging
Transcript: ENSMUST00000022226
AA Change: E248G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000022226
Gene: ENSMUSG00000021713
AA Change: E248G

DomainStartEndE-ValueType
WD40 80 117 2.96e-2 SMART
WD40 122 161 8.49e-3 SMART
Blast:WD40 164 207 9e-6 BLAST
WD40 211 251 2.76e0 SMART
WD40 269 308 1.4e-3 SMART
Blast:WD40 343 382 2e-6 BLAST
Blast:WD40 433 460 3e-7 BLAST
Pfam:Pro_isomerase 493 645 1.9e-52 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223755
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225798
Meta Mutation Damage Score 0.7855 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 94.9%
  • 20x: 87.8%
Validation Efficiency 99% (79/80)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik C T 3: 37,035,812 R4130* probably null Het
A2m C A 6: 121,654,612 L623M probably benign Het
Adamts13 A G 2: 26,996,583 E938G possibly damaging Het
Agfg1 A T 1: 82,893,538 Q497L probably damaging Het
Ahnak A G 19: 9,009,449 H2699R probably benign Het
Antxrl G T 14: 34,070,496 probably null Het
Apol7c A T 15: 77,526,218 V176E probably damaging Het
Arid5b T C 10: 68,277,947 N87D possibly damaging Het
Atp2c1 A T 9: 105,432,698 I560N probably damaging Het
Atp2c2 T C 8: 119,756,003 F868S possibly damaging Het
Blnk G C 19: 40,937,678 F326L probably benign Het
Ckap2 C T 8: 22,175,796 V412I possibly damaging Het
Clmn A G 12: 104,782,022 V422A probably benign Het
Ctnnal1 A G 4: 56,813,856 S638P probably benign Het
Cyp2j5 T C 4: 96,635,815 S327G probably benign Het
Dhx38 G A 8: 109,553,545 T871M probably damaging Het
Dmxl1 A T 18: 49,890,767 K1706* probably null Het
Dnah11 A G 12: 118,015,419 L2648P possibly damaging Het
Elf2 G A 3: 51,308,109 T60I probably damaging Het
Fam120b T A 17: 15,402,497 C246S possibly damaging Het
Fcho2 G T 13: 98,745,895 T451K possibly damaging Het
Fzd9 T A 5: 135,249,748 I428F probably damaging Het
Galnt13 T A 2: 54,854,655 V122E probably damaging Het
Gm21738 T A 14: 19,418,908 Y8F probably benign Het
Gnptab A G 10: 88,436,167 I940V possibly damaging Het
Gp2 A G 7: 119,451,498 probably null Het
Gpr6 A G 10: 41,070,534 S351P probably benign Het
Gprin1 T C 13: 54,739,876 E195G possibly damaging Het
Grm8 A T 6: 28,125,883 Y81* probably null Het
Gtf3c3 A T 1: 54,405,119 N703K probably damaging Het
H2afy T A 13: 56,104,909 N87Y probably damaging Het
Hhipl2 G A 1: 183,428,013 V495I probably benign Het
Islr G A 9: 58,158,219 probably benign Het
Lrrc36 T C 8: 105,449,641 Y216H possibly damaging Het
Me2 A G 18: 73,773,134 I528T probably benign Het
Mecr A T 4: 131,857,816 I156F possibly damaging Het
Megf6 A G 4: 154,262,510 probably benign Het
Mn1 T A 5: 111,421,569 L1135H probably damaging Het
Naip5 A G 13: 100,212,669 S1384P probably damaging Het
Nav2 A G 7: 49,452,465 N337S probably benign Het
Ndn C T 7: 62,348,508 P34L probably benign Het
Neb A T 2: 52,249,281 H3107Q probably benign Het
Nebl A G 2: 17,376,651 V738A possibly damaging Het
Nsd2 G A 5: 33,882,120 R825Q possibly damaging Het
Nsun2 A G 13: 69,627,586 N383S probably damaging Het
Ntrk3 A T 7: 78,247,288 M667K probably damaging Het
Olfr389 A G 11: 73,777,148 Y60H possibly damaging Het
Olfr514 A C 7: 108,825,235 C255G probably benign Het
Olfr745 G A 14: 50,643,108 V276M possibly damaging Het
Olfr791 A T 10: 129,526,619 M131L probably benign Het
Pex6 T C 17: 46,722,632 V633A probably benign Het
Phactr1 C T 13: 42,956,671 T95M probably damaging Het
Pik3r4 A G 9: 105,687,209 D1334G probably damaging Het
Pkhd1l1 A C 15: 44,597,117 I4241L probably benign Het
Prepl A C 17: 85,072,081 M393R probably benign Het
Ptpn6 T C 6: 124,721,185 S532G probably benign Het
Rnase11 G T 14: 51,049,601 H165Q possibly damaging Het
Sf1 A G 19: 6,372,060 N172S possibly damaging Het
Shprh T A 10: 11,157,078 D269E probably benign Het
Slc16a1 T C 3: 104,649,482 I61T possibly damaging Het
Slc38a2 A C 15: 96,692,536 I309S probably damaging Het
Sry C G Y: 2,663,149 Q170H unknown Het
Stk3 A C 15: 35,008,308 probably null Het
Tg C A 15: 66,696,166 C1306* probably null Het
Tnik A G 3: 28,665,740 M1254V probably damaging Het
U2surp T C 9: 95,484,227 E474G possibly damaging Het
Vmn1r224 T A 17: 20,419,325 F55I probably benign Het
Vmn1r32 A G 6: 66,552,955 I279T possibly damaging Het
Zc2hc1a A G 3: 7,516,483 D15G probably benign Het
Zfp827 C A 8: 79,076,346 P516T possibly damaging Het
Zfyve9 A T 4: 108,684,907 probably null Het
Other mutations in Ppwd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Ppwd1 APN 13 104217143 missense probably damaging 1.00
IGL01582:Ppwd1 APN 13 104213704 missense probably benign 0.01
IGL01697:Ppwd1 APN 13 104220464 missense probably benign 0.01
IGL01771:Ppwd1 APN 13 104217116 missense probably damaging 1.00
IGL02414:Ppwd1 APN 13 104223137 missense probably benign
IGL02803:Ppwd1 APN 13 104213684 missense probably benign 0.00
IGL02873:Ppwd1 APN 13 104209753 missense probably damaging 1.00
F5770:Ppwd1 UTSW 13 104220237 missense probably damaging 0.98
R0462:Ppwd1 UTSW 13 104222960 critical splice acceptor site probably null
R2211:Ppwd1 UTSW 13 104207142 missense probably benign 0.26
R2226:Ppwd1 UTSW 13 104217245 missense probably damaging 1.00
R2299:Ppwd1 UTSW 13 104220063 missense probably benign
R2353:Ppwd1 UTSW 13 104213582 missense probably benign
R2382:Ppwd1 UTSW 13 104207113 missense probably damaging 1.00
R3123:Ppwd1 UTSW 13 104213690 missense possibly damaging 0.90
R4521:Ppwd1 UTSW 13 104209659 missense probably benign 0.16
R4972:Ppwd1 UTSW 13 104220108 missense probably benign 0.00
R5125:Ppwd1 UTSW 13 104220435 missense probably benign 0.14
R5178:Ppwd1 UTSW 13 104220435 missense probably benign 0.14
R5468:Ppwd1 UTSW 13 104225444 missense possibly damaging 0.52
R5638:Ppwd1 UTSW 13 104220398 missense probably damaging 1.00
R6748:Ppwd1 UTSW 13 104208030 nonsense probably null
R7095:Ppwd1 UTSW 13 104205626 missense probably benign 0.21
R7201:Ppwd1 UTSW 13 104207172 missense probably damaging 1.00
R7206:Ppwd1 UTSW 13 104213598 missense probably damaging 0.99
R7664:Ppwd1 UTSW 13 104220290 missense probably damaging 1.00
R7746:Ppwd1 UTSW 13 104217206 missense probably damaging 1.00
V7580:Ppwd1 UTSW 13 104220237 missense probably damaging 0.98
V7581:Ppwd1 UTSW 13 104220237 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCTGAATCCCAACTTCTGTCACAGC -3'
(R):5'- GTGGATATATTGCCCAGGAGATGCC -3'

Sequencing Primer
(F):5'- CATcaatgcaagattaaagacaactg -3'
(R):5'- TATTGCCCAGGAGATGCCATATC -3'
Posted On2014-04-24