Incidental Mutation 'R1638:Olfr745'
ID 173332
Institutional Source Beutler Lab
Gene Symbol Olfr745
Ensembl Gene ENSMUSG00000050028
Gene Name olfactory receptor 745
Synonyms GA_x6K02T2PMLR-6361495-6362481, MOR106-11
MMRRC Submission 039674-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock # R1638 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 50639388-50643885 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 50643108 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 276 (V276M)
Ref Sequence ENSEMBL: ENSMUSP00000050184 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062534] [ENSMUST00000213127] [ENSMUST00000218546]
AlphaFold Q7TRL9
Predicted Effect possibly damaging
Transcript: ENSMUST00000062534
AA Change: V276M

PolyPhen 2 Score 0.926 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000050184
Gene: ENSMUSG00000050028
AA Change: V276M

transmembrane domain 5 27 N/A INTRINSIC
Pfam:7tm_4 44 324 6.3e-54 PFAM
Pfam:7TM_GPCR_Srsx 51 191 6.6e-6 PFAM
Pfam:7tm_1 57 306 1e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206749
Predicted Effect possibly damaging
Transcript: ENSMUST00000213127
AA Change: V270M

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216105
Predicted Effect probably benign
Transcript: ENSMUST00000218546
Meta Mutation Damage Score 0.1991 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 94.9%
  • 20x: 87.8%
Validation Efficiency 99% (79/80)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik C T 3: 37,035,812 R4130* probably null Het
A2m C A 6: 121,654,612 L623M probably benign Het
Adamts13 A G 2: 26,996,583 E938G possibly damaging Het
Agfg1 A T 1: 82,893,538 Q497L probably damaging Het
Ahnak A G 19: 9,009,449 H2699R probably benign Het
Antxrl G T 14: 34,070,496 probably null Het
Apol7c A T 15: 77,526,218 V176E probably damaging Het
Arid5b T C 10: 68,277,947 N87D possibly damaging Het
Atp2c1 A T 9: 105,432,698 I560N probably damaging Het
Atp2c2 T C 8: 119,756,003 F868S possibly damaging Het
Blnk G C 19: 40,937,678 F326L probably benign Het
Ckap2 C T 8: 22,175,796 V412I possibly damaging Het
Clmn A G 12: 104,782,022 V422A probably benign Het
Ctnnal1 A G 4: 56,813,856 S638P probably benign Het
Cyp2j5 T C 4: 96,635,815 S327G probably benign Het
Dhx38 G A 8: 109,553,545 T871M probably damaging Het
Dmxl1 A T 18: 49,890,767 K1706* probably null Het
Dnah11 A G 12: 118,015,419 L2648P possibly damaging Het
Elf2 G A 3: 51,308,109 T60I probably damaging Het
Fam120b T A 17: 15,402,497 C246S possibly damaging Het
Fcho2 G T 13: 98,745,895 T451K possibly damaging Het
Fzd9 T A 5: 135,249,748 I428F probably damaging Het
Galnt13 T A 2: 54,854,655 V122E probably damaging Het
Gm21738 T A 14: 19,418,908 Y8F probably benign Het
Gnptab A G 10: 88,436,167 I940V possibly damaging Het
Gp2 A G 7: 119,451,498 probably null Het
Gpr6 A G 10: 41,070,534 S351P probably benign Het
Gprin1 T C 13: 54,739,876 E195G possibly damaging Het
Grm8 A T 6: 28,125,883 Y81* probably null Het
Gtf3c3 A T 1: 54,405,119 N703K probably damaging Het
H2afy T A 13: 56,104,909 N87Y probably damaging Het
Hhipl2 G A 1: 183,428,013 V495I probably benign Het
Islr G A 9: 58,158,219 probably benign Het
Lrrc36 T C 8: 105,449,641 Y216H possibly damaging Het
Me2 A G 18: 73,773,134 I528T probably benign Het
Mecr A T 4: 131,857,816 I156F possibly damaging Het
Megf6 A G 4: 154,262,510 probably benign Het
Mn1 T A 5: 111,421,569 L1135H probably damaging Het
Naip5 A G 13: 100,212,669 S1384P probably damaging Het
Nav2 A G 7: 49,452,465 N337S probably benign Het
Ndn C T 7: 62,348,508 P34L probably benign Het
Neb A T 2: 52,249,281 H3107Q probably benign Het
Nebl A G 2: 17,376,651 V738A possibly damaging Het
Nsd2 G A 5: 33,882,120 R825Q possibly damaging Het
Nsun2 A G 13: 69,627,586 N383S probably damaging Het
Ntrk3 A T 7: 78,247,288 M667K probably damaging Het
Olfr389 A G 11: 73,777,148 Y60H possibly damaging Het
Olfr514 A C 7: 108,825,235 C255G probably benign Het
Olfr791 A T 10: 129,526,619 M131L probably benign Het
Pex6 T C 17: 46,722,632 V633A probably benign Het
Phactr1 C T 13: 42,956,671 T95M probably damaging Het
Pik3r4 A G 9: 105,687,209 D1334G probably damaging Het
Pkhd1l1 A C 15: 44,597,117 I4241L probably benign Het
Ppwd1 T C 13: 104,220,263 E248G probably damaging Het
Prepl A C 17: 85,072,081 M393R probably benign Het
Ptpn6 T C 6: 124,721,185 S532G probably benign Het
Rnase11 G T 14: 51,049,601 H165Q possibly damaging Het
Sf1 A G 19: 6,372,060 N172S possibly damaging Het
Shprh T A 10: 11,157,078 D269E probably benign Het
Slc16a1 T C 3: 104,649,482 I61T possibly damaging Het
Slc38a2 A C 15: 96,692,536 I309S probably damaging Het
Sry C G Y: 2,663,149 Q170H unknown Het
Stk3 A C 15: 35,008,308 probably null Het
Tg C A 15: 66,696,166 C1306* probably null Het
Tnik A G 3: 28,665,740 M1254V probably damaging Het
U2surp T C 9: 95,484,227 E474G possibly damaging Het
Vmn1r224 T A 17: 20,419,325 F55I probably benign Het
Vmn1r32 A G 6: 66,552,955 I279T possibly damaging Het
Zc2hc1a A G 3: 7,516,483 D15G probably benign Het
Zfp827 C A 8: 79,076,346 P516T possibly damaging Het
Zfyve9 A T 4: 108,684,907 probably null Het
Other mutations in Olfr745
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Olfr745 APN 14 50643168 missense probably benign 0.02
IGL02316:Olfr745 APN 14 50642287 missense probably benign 0.25
IGL02377:Olfr745 APN 14 50642518 splice site probably null
IGL02471:Olfr745 APN 14 50642757 missense probably benign 0.43
IGL02486:Olfr745 APN 14 50642632 missense probably damaging 1.00
IGL02517:Olfr745 APN 14 50643201 missense probably benign 0.01
R0453:Olfr745 UTSW 14 50643004 missense possibly damaging 0.90
R0727:Olfr745 UTSW 14 50643003 missense probably damaging 0.98
R0746:Olfr745 UTSW 14 50642775 splice site probably null
R1688:Olfr745 UTSW 14 50643248 missense probably benign 0.04
R1991:Olfr745 UTSW 14 50642866 missense possibly damaging 0.90
R2245:Olfr745 UTSW 14 50642605 missense probably damaging 1.00
R3758:Olfr745 UTSW 14 50643036 missense possibly damaging 0.96
R4084:Olfr745 UTSW 14 50642848 missense probably damaging 0.98
R5033:Olfr745 UTSW 14 50643162 missense probably damaging 1.00
R5211:Olfr745 UTSW 14 50643253 missense possibly damaging 0.78
R5302:Olfr745 UTSW 14 50642319 splice site probably null
R5645:Olfr745 UTSW 14 50643067 missense probably benign 0.00
R5731:Olfr745 UTSW 14 50642791 missense probably damaging 1.00
R6917:Olfr745 UTSW 14 50643223 missense possibly damaging 0.67
R7408:Olfr745 UTSW 14 50642395 missense probably benign 0.16
R7716:Olfr745 UTSW 14 50642358 missense probably benign 0.17
R7728:Olfr745 UTSW 14 50642392 missense probably benign 0.00
R8208:Olfr745 UTSW 14 50642631 missense probably benign 0.28
R8447:Olfr745 UTSW 14 50642551 missense probably benign 0.00
R8726:Olfr745 UTSW 14 50643246 missense probably benign 0.00
R8748:Olfr745 UTSW 14 50642754 missense probably benign 0.19
R9279:Olfr745 UTSW 14 50643036 missense possibly damaging 0.96
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- gtagcaaatggacaaaactggg -3'
Posted On 2014-04-24