Mutagenetix > Incidental Mutation

Incidental Mutation 'R1638:Me2'

173344

Institutional Source

Beutler Lab

Gene Symbol

Me2

Ensembl Gene

ENSMUSG00000024556

Gene Name

malic enzyme 2, NAD(+)-dependent, mitochondrial

Synonyms

D030040L20Rik

MMRRC Submission

039674-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1638 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

73770040-73815392 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 73773134 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 528 (I528T)

Ref Sequence

ENSEMBL: ENSMUSP00000025439 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025439]

AlphaFold

Q99KE1

Predicted Effect

probably benign
Transcript: ENSMUST00000025439
AA Change: I528T

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000025439
Gene: ENSMUSG00000024556
AA Change: I528T

Domain	Start	End	E-Value	Type
malic	89	270	3.48e-98	SMART
Malic_M	280	535	2.21e-103	SMART

Meta Mutation Damage Score

0.0906

Coding Region Coverage

1x: 99.0%
3x: 97.9%
10x: 94.9%
20x: 87.8%

Validation Efficiency

99% (79/80)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial NAD-dependent malic enzyme, a homotetrameric protein, that catalyzes the oxidative decarboxylation of malate to pyruvate. It had previously been weakly linked to a syndrome known as Friedreich ataxia that has since been shown to be the result of mutation in a completely different gene. Certain single-nucleotide polymorphism haplotypes of this gene have been shown to increase the risk for idiopathic generalized epilepsy. Alternatively spliced transcript variants encoding different isoforms found for this gene. [provided by RefSeq, Dec 2009]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	C	T	3: 37,035,812	R4130*	probably null	Het
A2m	C	A	6: 121,654,612	L623M	probably benign	Het
Adamts13	A	G	2: 26,996,583	E938G	possibly damaging	Het
Agfg1	A	T	1: 82,893,538	Q497L	probably damaging	Het
Ahnak	A	G	19: 9,009,449	H2699R	probably benign	Het
Antxrl	G	T	14: 34,070,496		probably null	Het
Apol7c	A	T	15: 77,526,218	V176E	probably damaging	Het
Arid5b	T	C	10: 68,277,947	N87D	possibly damaging	Het
Atp2c1	A	T	9: 105,432,698	I560N	probably damaging	Het
Atp2c2	T	C	8: 119,756,003	F868S	possibly damaging	Het
Blnk	G	C	19: 40,937,678	F326L	probably benign	Het
Ckap2	C	T	8: 22,175,796	V412I	possibly damaging	Het
Clmn	A	G	12: 104,782,022	V422A	probably benign	Het
Ctnnal1	A	G	4: 56,813,856	S638P	probably benign	Het
Cyp2j5	T	C	4: 96,635,815	S327G	probably benign	Het
Dhx38	G	A	8: 109,553,545	T871M	probably damaging	Het
Dmxl1	A	T	18: 49,890,767	K1706*	probably null	Het
Dnah11	A	G	12: 118,015,419	L2648P	possibly damaging	Het
Elf2	G	A	3: 51,308,109	T60I	probably damaging	Het
Fam120b	T	A	17: 15,402,497	C246S	possibly damaging	Het
Fcho2	G	T	13: 98,745,895	T451K	possibly damaging	Het
Fzd9	T	A	5: 135,249,748	I428F	probably damaging	Het
Galnt13	T	A	2: 54,854,655	V122E	probably damaging	Het
Gm21738	T	A	14: 19,418,908	Y8F	probably benign	Het
Gnptab	A	G	10: 88,436,167	I940V	possibly damaging	Het
Gp2	A	G	7: 119,451,498		probably null	Het
Gpr6	A	G	10: 41,070,534	S351P	probably benign	Het
Gprin1	T	C	13: 54,739,876	E195G	possibly damaging	Het
Grm8	A	T	6: 28,125,883	Y81*	probably null	Het
Gtf3c3	A	T	1: 54,405,119	N703K	probably damaging	Het
H2afy	T	A	13: 56,104,909	N87Y	probably damaging	Het
Hhipl2	G	A	1: 183,428,013	V495I	probably benign	Het
Islr	G	A	9: 58,158,219		probably benign	Het
Lrrc36	T	C	8: 105,449,641	Y216H	possibly damaging	Het
Mecr	A	T	4: 131,857,816	I156F	possibly damaging	Het
Megf6	A	G	4: 154,262,510		probably benign	Het
Mn1	T	A	5: 111,421,569	L1135H	probably damaging	Het
Naip5	A	G	13: 100,212,669	S1384P	probably damaging	Het
Nav2	A	G	7: 49,452,465	N337S	probably benign	Het
Ndn	C	T	7: 62,348,508	P34L	probably benign	Het
Neb	A	T	2: 52,249,281	H3107Q	probably benign	Het
Nebl	A	G	2: 17,376,651	V738A	possibly damaging	Het
Nsd2	G	A	5: 33,882,120	R825Q	possibly damaging	Het
Nsun2	A	G	13: 69,627,586	N383S	probably damaging	Het
Ntrk3	A	T	7: 78,247,288	M667K	probably damaging	Het
Olfr389	A	G	11: 73,777,148	Y60H	possibly damaging	Het
Olfr514	A	C	7: 108,825,235	C255G	probably benign	Het
Olfr745	G	A	14: 50,643,108	V276M	possibly damaging	Het
Olfr791	A	T	10: 129,526,619	M131L	probably benign	Het
Pex6	T	C	17: 46,722,632	V633A	probably benign	Het
Phactr1	C	T	13: 42,956,671	T95M	probably damaging	Het
Pik3r4	A	G	9: 105,687,209	D1334G	probably damaging	Het
Pkhd1l1	A	C	15: 44,597,117	I4241L	probably benign	Het
Ppwd1	T	C	13: 104,220,263	E248G	probably damaging	Het
Prepl	A	C	17: 85,072,081	M393R	probably benign	Het
Ptpn6	T	C	6: 124,721,185	S532G	probably benign	Het
Rnase11	G	T	14: 51,049,601	H165Q	possibly damaging	Het
Sf1	A	G	19: 6,372,060	N172S	possibly damaging	Het
Shprh	T	A	10: 11,157,078	D269E	probably benign	Het
Slc16a1	T	C	3: 104,649,482	I61T	possibly damaging	Het
Slc38a2	A	C	15: 96,692,536	I309S	probably damaging	Het
Sry	C	G	Y: 2,663,149	Q170H	unknown	Het
Stk3	A	C	15: 35,008,308		probably null	Het
Tg	C	A	15: 66,696,166	C1306*	probably null	Het
Tnik	A	G	3: 28,665,740	M1254V	probably damaging	Het
U2surp	T	C	9: 95,484,227	E474G	possibly damaging	Het
Vmn1r224	T	A	17: 20,419,325	F55I	probably benign	Het
Vmn1r32	A	G	6: 66,552,955	I279T	possibly damaging	Het
Zc2hc1a	A	G	3: 7,516,483	D15G	probably benign	Het
Zfp827	C	A	8: 79,076,346	P516T	possibly damaging	Het
Zfyve9	A	T	4: 108,684,907		probably null	Het

Other mutations in Me2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00435:Me2	APN	18	73770642	missense	probably benign	0.01
IGL00977:Me2	APN	18	73791177	missense	probably benign	0.24
IGL01161:Me2	APN	18	73770816	splice site	probably benign
IGL02351:Me2	APN	18	73797967	missense	probably benign	0.20
IGL02358:Me2	APN	18	73797967	missense	probably benign	0.20
IGL02647:Me2	APN	18	73797903	missense	probably benign	0.00
IGL03172:Me2	APN	18	73770726	missense	probably benign
Baako	UTSW	18	73797945	missense	probably damaging	1.00
excavator	UTSW	18	73781058	missense	probably damaging	1.00
first_born	UTSW	18	73791128	nonsense	probably null
muster	UTSW	18	73791844	missense	probably benign	0.01
powerhouse	UTSW	18	73785729	missense	probably damaging	1.00
roundup	UTSW	18	73770673	missense	probably benign
R0018:Me2	UTSW	18	73791852	missense	possibly damaging	0.93
R0018:Me2	UTSW	18	73791852	missense	possibly damaging	0.93
R0032:Me2	UTSW	18	73794525	missense	probably benign
R0119:Me2	UTSW	18	73770673	missense	probably benign
R0136:Me2	UTSW	18	73770673	missense	probably benign
R0299:Me2	UTSW	18	73770673	missense	probably benign
R0657:Me2	UTSW	18	73770673	missense	probably benign
R1597:Me2	UTSW	18	73797945	missense	probably damaging	1.00
R1765:Me2	UTSW	18	73791858	missense	probably damaging	1.00
R1861:Me2	UTSW	18	73785714	missense	probably benign	0.11
R2410:Me2	UTSW	18	73791112	missense	probably damaging	0.98
R3422:Me2	UTSW	18	73791194	missense	probably damaging	0.99
R3954:Me2	UTSW	18	73781132	missense	probably damaging	1.00
R3957:Me2	UTSW	18	73781132	missense	probably damaging	1.00
R4052:Me2	UTSW	18	73791085	missense	probably benign	0.05
R4207:Me2	UTSW	18	73791085	missense	probably benign	0.05
R4208:Me2	UTSW	18	73791085	missense	probably benign	0.05
R4694:Me2	UTSW	18	73801859	missense	probably benign	0.01
R4962:Me2	UTSW	18	73785776	missense	probably damaging	1.00
R5527:Me2	UTSW	18	73791116	missense	probably damaging	1.00
R6170:Me2	UTSW	18	73785781	missense	probably benign	0.07
R6185:Me2	UTSW	18	73791128	nonsense	probably null
R6305:Me2	UTSW	18	73791844	missense	probably benign	0.01
R6462:Me2	UTSW	18	73775399	missense	probably benign	0.17
R7015:Me2	UTSW	18	73781147	splice site	probably null
R7085:Me2	UTSW	18	73781058	missense	probably damaging	1.00
R7096:Me2	UTSW	18	73794890	missense	probably benign	0.05
R9373:Me2	UTSW	18	73785729	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGCCGTGCATATTTTCCTGAGCC -3'
(R):5'- cccctttctccacaCATGATGAGC -3'

Sequencing Primer
(F):5'- CCATCATCCAGAATATGTGGGTC -3'
(R):5'- ctccacaCATGATGAGCAGTTTTAC -3'

Posted On

2014-04-24