Incidental Mutation 'R1638:Blnk'
ID 173347
Institutional Source Beutler Lab
Gene Symbol Blnk
Ensembl Gene ENSMUSG00000061132
Gene Name B cell linker
Synonyms BASH, Bca, SLP-65, BCA, BLNK, Ly-57, Ly57
MMRRC Submission 039674-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.148) question?
Stock # R1638 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 40928927-40994535 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to C at 40937678 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 326 (F326L)
Ref Sequence ENSEMBL: ENSMUSP00000112473 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054769] [ENSMUST00000117695]
AlphaFold Q9QUN3
Predicted Effect probably benign
Transcript: ENSMUST00000054769
AA Change: F329L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000057844
Gene: ENSMUSG00000061132
AA Change: F329L

DomainStartEndE-ValueType
Blast:SH2 139 180 6e-8 BLAST
low complexity region 235 247 N/A INTRINSIC
low complexity region 251 266 N/A INTRINSIC
SH2 345 436 3.07e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117695
AA Change: F326L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000112473
Gene: ENSMUSG00000061132
AA Change: F326L

DomainStartEndE-ValueType
Blast:SH2 139 180 6e-8 BLAST
low complexity region 235 247 N/A INTRINSIC
low complexity region 251 266 N/A INTRINSIC
SH2 342 433 3.07e-19 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 94.9%
  • 20x: 87.8%
Validation Efficiency 99% (79/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic linker or adaptor protein that plays a critical role in B cell development. This protein bridges B cell receptor-associated kinase activation with downstream signaling pathways, thereby affecting various biological functions. The phosphorylation of five tyrosine residues is necessary for this protein to nucleate distinct signaling effectors following B cell receptor activation. Mutations in this gene cause hypoglobulinemia and absent B cells, a disease in which the pro- to pre-B-cell transition is developmentally blocked. Deficiency in this protein has also been shown in some cases of pre-B acute lymphoblastic leukemia. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Homozygotes for targeted null mutations exhibit a partial block in pre-B cell development, a lack of B1 B cells, reduced numbers of mature B cells, lower IgM and IgG3 serum levels, poor IgM immune responses, and a high incidence of pre-B cell lymphoma. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik C T 3: 37,035,812 R4130* probably null Het
A2m C A 6: 121,654,612 L623M probably benign Het
Adamts13 A G 2: 26,996,583 E938G possibly damaging Het
Agfg1 A T 1: 82,893,538 Q497L probably damaging Het
Ahnak A G 19: 9,009,449 H2699R probably benign Het
Antxrl G T 14: 34,070,496 probably null Het
Apol7c A T 15: 77,526,218 V176E probably damaging Het
Arid5b T C 10: 68,277,947 N87D possibly damaging Het
Atp2c1 A T 9: 105,432,698 I560N probably damaging Het
Atp2c2 T C 8: 119,756,003 F868S possibly damaging Het
Ckap2 C T 8: 22,175,796 V412I possibly damaging Het
Clmn A G 12: 104,782,022 V422A probably benign Het
Ctnnal1 A G 4: 56,813,856 S638P probably benign Het
Cyp2j5 T C 4: 96,635,815 S327G probably benign Het
Dhx38 G A 8: 109,553,545 T871M probably damaging Het
Dmxl1 A T 18: 49,890,767 K1706* probably null Het
Dnah11 A G 12: 118,015,419 L2648P possibly damaging Het
Elf2 G A 3: 51,308,109 T60I probably damaging Het
Fam120b T A 17: 15,402,497 C246S possibly damaging Het
Fcho2 G T 13: 98,745,895 T451K possibly damaging Het
Fzd9 T A 5: 135,249,748 I428F probably damaging Het
Galnt13 T A 2: 54,854,655 V122E probably damaging Het
Gm21738 T A 14: 19,418,908 Y8F probably benign Het
Gnptab A G 10: 88,436,167 I940V possibly damaging Het
Gp2 A G 7: 119,451,498 probably null Het
Gpr6 A G 10: 41,070,534 S351P probably benign Het
Gprin1 T C 13: 54,739,876 E195G possibly damaging Het
Grm8 A T 6: 28,125,883 Y81* probably null Het
Gtf3c3 A T 1: 54,405,119 N703K probably damaging Het
H2afy T A 13: 56,104,909 N87Y probably damaging Het
Hhipl2 G A 1: 183,428,013 V495I probably benign Het
Islr G A 9: 58,158,219 probably benign Het
Lrrc36 T C 8: 105,449,641 Y216H possibly damaging Het
Me2 A G 18: 73,773,134 I528T probably benign Het
Mecr A T 4: 131,857,816 I156F possibly damaging Het
Megf6 A G 4: 154,262,510 probably benign Het
Mn1 T A 5: 111,421,569 L1135H probably damaging Het
Naip5 A G 13: 100,212,669 S1384P probably damaging Het
Nav2 A G 7: 49,452,465 N337S probably benign Het
Ndn C T 7: 62,348,508 P34L probably benign Het
Neb A T 2: 52,249,281 H3107Q probably benign Het
Nebl A G 2: 17,376,651 V738A possibly damaging Het
Nsd2 G A 5: 33,882,120 R825Q possibly damaging Het
Nsun2 A G 13: 69,627,586 N383S probably damaging Het
Ntrk3 A T 7: 78,247,288 M667K probably damaging Het
Olfr389 A G 11: 73,777,148 Y60H possibly damaging Het
Olfr514 A C 7: 108,825,235 C255G probably benign Het
Olfr745 G A 14: 50,643,108 V276M possibly damaging Het
Olfr791 A T 10: 129,526,619 M131L probably benign Het
Pex6 T C 17: 46,722,632 V633A probably benign Het
Phactr1 C T 13: 42,956,671 T95M probably damaging Het
Pik3r4 A G 9: 105,687,209 D1334G probably damaging Het
Pkhd1l1 A C 15: 44,597,117 I4241L probably benign Het
Ppwd1 T C 13: 104,220,263 E248G probably damaging Het
Prepl A C 17: 85,072,081 M393R probably benign Het
Ptpn6 T C 6: 124,721,185 S532G probably benign Het
Rnase11 G T 14: 51,049,601 H165Q possibly damaging Het
Sf1 A G 19: 6,372,060 N172S possibly damaging Het
Shprh T A 10: 11,157,078 D269E probably benign Het
Slc16a1 T C 3: 104,649,482 I61T possibly damaging Het
Slc38a2 A C 15: 96,692,536 I309S probably damaging Het
Sry C G Y: 2,663,149 Q170H unknown Het
Stk3 A C 15: 35,008,308 probably null Het
Tg C A 15: 66,696,166 C1306* probably null Het
Tnik A G 3: 28,665,740 M1254V probably damaging Het
U2surp T C 9: 95,484,227 E474G possibly damaging Het
Vmn1r224 T A 17: 20,419,325 F55I probably benign Het
Vmn1r32 A G 6: 66,552,955 I279T possibly damaging Het
Zc2hc1a A G 3: 7,516,483 D15G probably benign Het
Zfp827 C A 8: 79,076,346 P516T possibly damaging Het
Zfyve9 A T 4: 108,684,907 probably null Het
Other mutations in Blnk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Blnk APN 19 40934446 missense probably benign 0.15
IGL01286:Blnk APN 19 40934506 missense probably benign 0.00
IGL02090:Blnk APN 19 40934485 missense probably benign 0.38
IGL02814:Blnk APN 19 40962429 missense probably damaging 1.00
IGL02831:Blnk APN 19 40962429 missense probably damaging 1.00
IGL03024:Blnk APN 19 40994002 splice site probably benign
Augen UTSW 19 40929291 missense probably damaging 1.00
Blick UTSW 19 40934459 missense probably damaging 1.00
busy UTSW 19 40952391 nonsense probably null
There UTSW 19 40952390 missense possibly damaging 0.94
IGL02988:Blnk UTSW 19 40929216 missense probably damaging 1.00
R0140:Blnk UTSW 19 40940224 missense probably damaging 0.99
R0671:Blnk UTSW 19 40937667 nonsense probably null
R1617:Blnk UTSW 19 40962363 missense probably benign
R1803:Blnk UTSW 19 40952377 missense probably damaging 0.96
R1970:Blnk UTSW 19 40940165 splice site probably benign
R2880:Blnk UTSW 19 40962455 missense probably damaging 1.00
R2980:Blnk UTSW 19 40962350 missense probably damaging 1.00
R5421:Blnk UTSW 19 40968523 missense probably damaging 1.00
R5987:Blnk UTSW 19 40929289 missense possibly damaging 0.95
R6321:Blnk UTSW 19 40934459 missense probably damaging 1.00
R6703:Blnk UTSW 19 40962506 splice site probably null
R6970:Blnk UTSW 19 40962377 missense probably damaging 0.99
R7101:Blnk UTSW 19 40972638 missense probably benign 0.01
R7432:Blnk UTSW 19 40959857 nonsense probably null
R7560:Blnk UTSW 19 40952390 missense possibly damaging 0.94
R7797:Blnk UTSW 19 40959788 missense possibly damaging 0.51
R8287:Blnk UTSW 19 40929291 missense probably damaging 1.00
R8473:Blnk UTSW 19 40952410 missense possibly damaging 0.81
R8798:Blnk UTSW 19 40962351 missense probably damaging 1.00
R9094:Blnk UTSW 19 40994039 missense probably benign 0.39
R9139:Blnk UTSW 19 40934518 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCACCTTCAAGGGCACACAGTG -3'
(R):5'- GAGCAGTCCTGAGGAGTTTTCAGC -3'

Sequencing Primer
(F):5'- acaaacaaacaaacaaacaaacaaac -3'
(R):5'- AGCTCTGTGTGTGGCCC -3'
Posted On 2014-04-24