Mutagenetix > Incidental Mutations

Incidental Mutation 'R1638:Blnk'

173347

Institutional Source

Beutler Lab

Gene Symbol

Blnk

Ensembl Gene

ENSMUSG00000061132

Gene Name

B cell linker

Synonyms

BASH, Bca, SLP-65, BCA, BLNK, Ly-57, Ly57

MMRRC Submission

039674-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.143) question?

Stock #

R1638 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

40928927-40994535 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to C at 40937678 bp

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 326 (F326L)

Ref Sequence

ENSEMBL: ENSMUSP00000112473 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000054769] [ENSMUST00000117695]

Predicted Effect

probably benign
Transcript: ENSMUST00000054769
AA Change: F329L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000057844
Gene: ENSMUSG00000061132
AA Change: F329L

Domain	Start	End	E-Value	Type
Blast:SH2	139	180	6e-8	BLAST
low complexity region	235	247	N/A	INTRINSIC
low complexity region	251	266	N/A	INTRINSIC
SH2	345	436	3.07e-19	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000117695
AA Change: F326L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000112473
Gene: ENSMUSG00000061132
AA Change: F326L

Domain	Start	End	E-Value	Type
Blast:SH2	139	180	6e-8	BLAST
low complexity region	235	247	N/A	INTRINSIC
low complexity region	251	266	N/A	INTRINSIC
SH2	342	433	3.07e-19	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.0%
3x: 97.9%
10x: 94.9%
20x: 87.8%

Validation Efficiency

99% (79/80)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic linker or adaptor protein that plays a critical role in B cell development. This protein bridges B cell receptor-associated kinase activation with downstream signaling pathways, thereby affecting various biological functions. The phosphorylation of five tyrosine residues is necessary for this protein to nucleate distinct signaling effectors following B cell receptor activation. Mutations in this gene cause hypoglobulinemia and absent B cells, a disease in which the pro- to pre-B-cell transition is developmentally blocked. Deficiency in this protein has also been shown in some cases of pre-B acute lymphoblastic leukemia. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Homozygotes for targeted null mutations exhibit a partial block in pre-B cell development, a lack of B1 B cells, reduced numbers of mature B cells, lower IgM and IgG3 serum levels, poor IgM immune responses, and a high incidence of pre-B cell lymphoma. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	C	T	3: 37,035,812	R4130*	probably null	Het
A2m	C	A	6: 121,654,612	L623M	probably benign	Het
Adamts13	A	G	2: 26,996,583	E938G	possibly damaging	Het
Agfg1	A	T	1: 82,893,538	Q497L	probably damaging	Het
Ahnak	A	G	19: 9,009,449	H2699R	probably benign	Het
Antxrl	G	T	14: 34,070,496		probably null	Het
Apol7c	A	T	15: 77,526,218	V176E	probably damaging	Het
Arid5b	T	C	10: 68,277,947	N87D	possibly damaging	Het
Atp2c1	A	T	9: 105,432,698	I560N	probably damaging	Het
Atp2c2	T	C	8: 119,756,003	F868S	possibly damaging	Het
Ckap2	C	T	8: 22,175,796	V412I	possibly damaging	Het
Clmn	A	G	12: 104,782,022	V422A	probably benign	Het
Ctnnal1	A	G	4: 56,813,856	S638P	probably benign	Het
Cyp2j5	T	C	4: 96,635,815	S327G	probably benign	Het
Dhx38	G	A	8: 109,553,545	T871M	probably damaging	Het
Dmxl1	A	T	18: 49,890,767	K1706*	probably null	Het
Dnah11	A	G	12: 118,015,419	L2648P	possibly damaging	Het
Elf2	G	A	3: 51,308,109	T60I	probably damaging	Het
Fam120b	T	A	17: 15,402,497	C246S	possibly damaging	Het
Fcho2	G	T	13: 98,745,895	T451K	possibly damaging	Het
Fzd9	T	A	5: 135,249,748	I428F	probably damaging	Het
Galnt13	T	A	2: 54,854,655	V122E	probably damaging	Het
Gm21738	T	A	14: 19,418,908	Y8F	probably benign	Het
Gnptab	A	G	10: 88,436,167	I940V	possibly damaging	Het
Gp2	A	G	7: 119,451,498		probably null	Het
Gpr6	A	G	10: 41,070,534	S351P	probably benign	Het
Gprin1	T	C	13: 54,739,876	E195G	possibly damaging	Het
Grm8	A	T	6: 28,125,883	Y81*	probably null	Het
Gtf3c3	A	T	1: 54,405,119	N703K	probably damaging	Het
H2afy	T	A	13: 56,104,909	N87Y	probably damaging	Het
Hhipl2	G	A	1: 183,428,013	V495I	probably benign	Het
Islr	G	A	9: 58,158,219		probably benign	Het
Lrrc36	T	C	8: 105,449,641	Y216H	possibly damaging	Het
Me2	A	G	18: 73,773,134	I528T	probably benign	Het
Mecr	A	T	4: 131,857,816	I156F	possibly damaging	Het
Megf6	A	G	4: 154,262,510		probably benign	Het
Mn1	T	A	5: 111,421,569	L1135H	probably damaging	Het
Naip5	A	G	13: 100,212,669	S1384P	probably damaging	Het
Nav2	A	G	7: 49,452,465	N337S	probably benign	Het
Ndn	C	T	7: 62,348,508	P34L	probably benign	Het
Neb	A	T	2: 52,249,281	H3107Q	probably benign	Het
Nebl	A	G	2: 17,376,651	V738A	possibly damaging	Het
Nsd2	G	A	5: 33,882,120	R825Q	possibly damaging	Het
Nsun2	A	G	13: 69,627,586	N383S	probably damaging	Het
Ntrk3	A	T	7: 78,247,288	M667K	probably damaging	Het
Olfr389	A	G	11: 73,777,148	Y60H	possibly damaging	Het
Olfr514	A	C	7: 108,825,235	C255G	probably benign	Het
Olfr745	G	A	14: 50,643,108	V276M	possibly damaging	Het
Olfr791	A	T	10: 129,526,619	M131L	probably benign	Het
Pex6	T	C	17: 46,722,632	V633A	probably benign	Het
Phactr1	C	T	13: 42,956,671	T95M	probably damaging	Het
Pik3r4	A	G	9: 105,687,209	D1334G	probably damaging	Het
Pkhd1l1	A	C	15: 44,597,117	I4241L	probably benign	Het
Ppwd1	T	C	13: 104,220,263	E248G	probably damaging	Het
Prepl	A	C	17: 85,072,081	M393R	probably benign	Het
Ptpn6	T	C	6: 124,721,185	S532G	probably benign	Het
Rnase11	G	T	14: 51,049,601	H165Q	possibly damaging	Het
Sf1	A	G	19: 6,372,060	N172S	possibly damaging	Het
Shprh	T	A	10: 11,157,078	D269E	probably benign	Het
Slc16a1	T	C	3: 104,649,482	I61T	possibly damaging	Het
Slc38a2	A	C	15: 96,692,536	I309S	probably damaging	Het
Sry	C	G	Y: 2,663,149	Q170H	unknown	Het
Stk3	A	C	15: 35,008,308		probably null	Het
Tg	C	A	15: 66,696,166	C1306*	probably null	Het
Tnik	A	G	3: 28,665,740	M1254V	probably damaging	Het
U2surp	T	C	9: 95,484,227	E474G	possibly damaging	Het
Vmn1r224	T	A	17: 20,419,325	F55I	probably benign	Het
Vmn1r32	A	G	6: 66,552,955	I279T	possibly damaging	Het
Zc2hc1a	A	G	3: 7,516,483	D15G	probably benign	Het
Zfp827	C	A	8: 79,076,346	P516T	possibly damaging	Het
Zfyve9	A	T	4: 108,684,907		probably null	Het

Other mutations in Blnk

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00780:Blnk	APN	19	40934446	missense	probably benign	0.15
IGL01286:Blnk	APN	19	40934506	missense	probably benign	0.00
IGL02090:Blnk	APN	19	40934485	missense	probably benign	0.38
IGL02814:Blnk	APN	19	40962429	missense	probably damaging	1.00
IGL02831:Blnk	APN	19	40962429	missense	probably damaging	1.00
IGL03024:Blnk	APN	19	40994002	splice site	probably benign
busy	UTSW	19	40952391	nonsense	probably null
There	UTSW	19	40952390	missense	possibly damaging	0.94
IGL02988:Blnk	UTSW	19	40929216	missense	probably damaging	1.00
R0140:Blnk	UTSW	19	40940224	missense	probably damaging	0.99
R0671:Blnk	UTSW	19	40937667	nonsense	probably null
R1617:Blnk	UTSW	19	40962363	missense	probably benign
R1803:Blnk	UTSW	19	40952377	missense	probably damaging	0.96
R1970:Blnk	UTSW	19	40940165	splice site	probably benign
R2880:Blnk	UTSW	19	40962455	missense	probably damaging	1.00
R2980:Blnk	UTSW	19	40962350	missense	probably damaging	1.00
R5421:Blnk	UTSW	19	40968523	missense	probably damaging	1.00
R5987:Blnk	UTSW	19	40929289	missense	possibly damaging	0.95
R6321:Blnk	UTSW	19	40934459	missense	probably damaging	1.00
R6703:Blnk	UTSW	19	40962506	splice site	probably null
R6970:Blnk	UTSW	19	40962377	missense	probably damaging	0.99
R7101:Blnk	UTSW	19	40972638	missense	probably benign	0.01
R7432:Blnk	UTSW	19	40959857	nonsense	probably null
R7560:Blnk	UTSW	19	40952390	missense	possibly damaging	0.94
R7797:Blnk	UTSW	19	40959788	missense	possibly damaging	0.51
R8287:Blnk	UTSW	19	40929291	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCACCTTCAAGGGCACACAGTG -3'
(R):5'- GAGCAGTCCTGAGGAGTTTTCAGC -3'

Sequencing Primer
(F):5'- acaaacaaacaaacaaacaaacaaac -3'
(R):5'- AGCTCTGTGTGTGGCCC -3'

Posted On

2014-04-24