Mutagenetix > Incidental Mutations

Incidental Mutation 'R1640:Ncf2'

173419

Institutional Source

Beutler Lab

Gene Symbol

Ncf2

Ensembl Gene

ENSMUSG00000026480

Gene Name

neutrophil cytosolic factor 2

Synonyms

NOXA2, p67phox, Ncf-2, NADPH oxidase subunit (67kDa)

MMRRC Submission

039676-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.104) question?

Stock #

R1640 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

152800194-152836991 bp(+) (GRCm38)

Type of Mutation

start codon destroyed

DNA Base Change (assembly)

T to A at 152808033 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 1 (M1K)

Ref Sequence

ENSEMBL: ENSMUSP00000140404 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027754] [ENSMUST00000186568] [ENSMUST00000190323]

Predicted Effect

probably null
Transcript: ENSMUST00000027754
AA Change: M1K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000027754
Gene: ENSMUSG00000026480
AA Change: M1K

Domain	Start	End	E-Value	Type
TPR	37	70	1.42e0	SMART
TPR	71	104	3.58e-6	SMART
TPR	121	154	1.05e1	SMART
SH3	243	298	1.02e-13	SMART
low complexity region	312	326	N/A	INTRINSIC
PB1	350	428	2.6e-10	SMART
SH3	459	514	8.36e-19	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000186568
AA Change: M1K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000140404
Gene: ENSMUSG00000026480
AA Change: M1K

Domain	Start	End	E-Value	Type
TPR	37	70	1.42e0	SMART
TPR	71	104	3.58e-6	SMART
TPR	121	154	1.05e1	SMART
SH3	243	298	1.02e-13	SMART
low complexity region	312	326	N/A	INTRINSIC
PB1	350	428	2.6e-10	SMART
SH3	459	514	8.36e-19	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000187641

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000189135

Predicted Effect

probably benign
Transcript: ENSMUST00000190323

SMART Domains

Protein: ENSMUSP00000139774
Gene: ENSMUSG00000026480

Domain	Start	End	E-Value	Type
Pfam:TPR_1	1	26	5.8e-4	PFAM
low complexity region	54	69	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.1%
20x: 92.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes neutrophil cytosolic factor 2, the 67-kilodalton cytosolic subunit of the multi-protein NADPH oxidase complex found in neutrophils. This oxidase produces a burst of superoxide which is delivered to the lumen of the neutrophil phagosome. Mutations in this gene, as well as in other NADPH oxidase subunits, can result in chronic granulomatous disease, a disease that causes recurrent infections by catalase-positive organisms. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jun 2010]

Allele List at MGI

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810004N23Rik	C	A	8: 124,839,845	V279L	probably damaging	Het
4931417E11Rik	A	G	6: 73,468,886	Y227H	probably benign	Het
Acot6	A	T	12: 84,101,126	Y52F	probably damaging	Het
Adam22	C	T	5: 8,145,689	V284I	probably damaging	Het
Agl	A	T	3: 116,752,090	H1352Q	probably benign	Het
Aldh18a1	G	A	19: 40,585,499	P27S	probably benign	Het
C1ra	A	G	6: 124,522,274	N473S	probably benign	Het
C87436	T	C	6: 86,446,251	L269P	probably damaging	Het
Calcrl	A	G	2: 84,333,677	V390A	probably damaging	Het
Ccp110	T	G	7: 118,715,528		probably null	Het
Cerk	A	G	15: 86,149,400	V274A	probably damaging	Het
Chd1l	A	T	3: 97,580,991	S570T	probably benign	Het
Chst14	T	A	2: 118,926,898	W83R	probably damaging	Het
Chsy1	A	T	7: 66,171,514	D499V	probably benign	Het
Ckmt1	C	A	2: 121,359,717		probably null	Het
Cnot1	A	T	8: 95,769,832	V282D	probably damaging	Het
Cntn3	A	T	6: 102,242,013	S549T	possibly damaging	Het
Cntnap5c	A	T	17: 58,395,294	D1203V	probably benign	Het
Col4a4	A	G	1: 82,535,770	Y169H	unknown	Het
Cwc22	A	G	2: 77,915,530	F454S	possibly damaging	Het
Dab1	C	T	4: 104,731,751	A524V	probably benign	Het
Dhrs7	A	T	12: 72,652,315	W298R	possibly damaging	Het
Dock7	G	T	4: 98,945,246	T1906N	probably damaging	Het
Dpy19l3	T	C	7: 35,749,778	T67A	probably benign	Het
Drc1	A	G	5: 30,363,957	D654G	possibly damaging	Het
Ech1	A	T	7: 28,831,839	H284L	probably damaging	Het
Epc1	G	A	18: 6,441,175	Q8*	probably null	Het
Etv5	A	T	16: 22,435,914	D65E	probably damaging	Het
F2rl3	A	G	8: 72,762,906	R254G	probably benign	Het
Fabp5	T	G	3: 10,015,110	F73L	probably benign	Het
Fbrs	T	C	7: 127,487,311	I611T	probably damaging	Het
Flnc	T	C	6: 29,433,807	S117P	possibly damaging	Het
Frmd4b	A	C	6: 97,308,673	S291A	possibly damaging	Het
Galnt13	A	G	2: 55,060,546	Y413C	probably damaging	Het
Gfer	A	G	17: 24,695,363	Y109H	possibly damaging	Het
Gli2	T	C	1: 118,836,524	H1299R	possibly damaging	Het
Gm10110	T	C	14: 89,898,243		noncoding transcript	Het
Gprc5a	T	G	6: 135,078,654	L33W	probably damaging	Het
Grin3a	T	C	4: 49,844,721	T121A	probably benign	Het
Grk3	A	G	5: 113,015,382	V33A	probably benign	Het
Hc	A	T	2: 35,057,324	Y59*	probably null	Het
Hrnr	A	G	3: 93,332,516	I3354V	unknown	Het
Hyou1	C	G	9: 44,389,406	T924S	probably benign	Het
Ifi209	T	G	1: 173,637,365	H20Q	probably damaging	Het
Ifi44	A	G	3: 151,732,534	V372A	probably benign	Het
Igdcc4	T	A	9: 65,122,795	L328H	probably damaging	Het
Kif18a	A	G	2: 109,289,816	T155A	probably benign	Het
Kmt2d	A	G	15: 98,845,057		probably benign	Het
Kri1	T	C	9: 21,280,457	D281G	possibly damaging	Het
Larp1b	T	A	3: 41,034,072	M1K	probably null	Het
Loxhd1	A	G	18: 77,402,563	D1225G	probably damaging	Het
Mzf1	A	G	7: 13,043,270	*736Q	probably null	Het
Naip2	C	T	13: 100,161,981	A516T	possibly damaging	Het
Olfr1095	T	A	2: 86,851,227	H157L	probably benign	Het
Olfr1100	A	C	2: 86,978,619	M59R	probably damaging	Het
Parp12	T	C	6: 39,096,640	D417G	probably benign	Het
Parp12	T	C	6: 39,111,678	H208R	probably damaging	Het
Pcif1	T	C	2: 164,885,683	I132T	probably benign	Het
Pck2	A	G	14: 55,548,584	D610G	possibly damaging	Het
Plbd1	T	C	6: 136,640,125	K185E	probably benign	Het
Ppp2r5a	T	C	1: 191,353,929	M425V	probably damaging	Het
Rapgef6	T	A	11: 54,657,405	V805D	probably damaging	Het
Rprd2	C	T	3: 95,763,747		probably benign	Het
Ryr3	A	G	2: 112,900,833	S711P	probably damaging	Het
Slc17a3	T	A	13: 23,852,357	L212*	probably null	Het
Slc4a8	A	G	15: 100,783,787	D41G	probably benign	Het
Slc9a3	T	A	13: 74,158,818	V354E	probably damaging	Het
Spen	A	G	4: 141,468,943	I3632T	probably damaging	Het
Tesc	A	G	5: 118,054,849	S77G	probably benign	Het
Tet3	A	T	6: 83,369,315	V1245D	probably benign	Het
Tox4	T	A	14: 52,292,543	D553E	possibly damaging	Het
Tpmt	A	T	13: 47,027,283	Y193*	probably null	Het
Trio	T	C	15: 27,833,044	Y1169C	probably damaging	Het
Urb1	G	A	16: 90,772,626	T1404I	probably benign	Het
Usp47	T	C	7: 112,083,127	S540P	probably damaging	Het
Vmn1r178	A	T	7: 23,894,123	M126L	possibly damaging	Het
Vmn1r223	T	C	13: 23,250,178	F314S	probably damaging	Het
Vmn2r112	A	T	17: 22,605,116	I451L	probably benign	Het
Zfc3h1	A	G	10: 115,406,901		probably null	Het
Zfp503	A	T	14: 21,984,901	L649Q	probably damaging	Het
Zfp977	A	C	7: 42,580,106	C332G	probably damaging	Het

Other mutations in Ncf2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00572:Ncf2	APN	1	152808174	missense	possibly damaging	0.49
IGL00952:Ncf2	APN	1	152836106	missense	probably benign	0.19
IGL01504:Ncf2	APN	1	152833329	missense	probably benign	0.00
IGL01693:Ncf2	APN	1	152824323	missense	probably benign	0.00
IGL02005:Ncf2	APN	1	152817052	missense	possibly damaging	0.73
IGL02041:Ncf2	APN	1	152836120	utr 3 prime	probably benign
IGL02327:Ncf2	APN	1	152816993	missense	possibly damaging	0.49
IGL02366:Ncf2	APN	1	152835073	missense	probably benign
IGL02627:Ncf2	APN	1	152811008	splice site	probably benign
R0560:Ncf2	UTSW	1	152821522	missense	probably damaging	1.00
R1136:Ncf2	UTSW	1	152830372	missense	probably damaging	1.00
R1673:Ncf2	UTSW	1	152830479	missense	probably benign	0.13
R1836:Ncf2	UTSW	1	152808071	missense	probably damaging	1.00
R1873:Ncf2	UTSW	1	152825910	missense	probably benign	0.00
R1940:Ncf2	UTSW	1	152834064	splice site	probably benign
R1967:Ncf2	UTSW	1	152830372	missense	probably damaging	1.00
R3405:Ncf2	UTSW	1	152825947	unclassified	probably benign
R3406:Ncf2	UTSW	1	152825947	unclassified	probably benign
R4501:Ncf2	UTSW	1	152835033	missense	probably benign	0.00
R4503:Ncf2	UTSW	1	152833778	missense	probably benign	0.20
R4563:Ncf2	UTSW	1	152808225	intron	probably benign
R5841:Ncf2	UTSW	1	152821518	splice site	silent
R6336:Ncf2	UTSW	1	152834070	missense	probably damaging	1.00
R6385:Ncf2	UTSW	1	152830422	missense	probably benign	0.00
R6522:Ncf2	UTSW	1	152827463	critical splice donor site	probably null
R6811:Ncf2	UTSW	1	152836040	missense	probably benign	0.00
R7048:Ncf2	UTSW	1	152808170	missense	probably benign
R8224:Ncf2	UTSW	1	152830393	missense	possibly damaging	0.83
R8256:Ncf2	UTSW	1	152817100	critical splice donor site	probably null
X0066:Ncf2	UTSW	1	152810979	start codon destroyed	probably null	0.27
Z1177:Ncf2	UTSW	1	152825942	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- TCTTAGAGGAACTGACCAGCCCAC -3'
(R):5'- TTCCAGGATAGTGTTCACGCAGCC -3'

Sequencing Primer
(F):5'- CTCATGCTAGTTTATGCGTCAG -3'
(R):5'- TCACGCAGCCTATGTTGAAG -3'

Posted On

2014-04-24