Incidental Mutation 'R1640:Ppp2r5a'
ID173421
Institutional Source Beutler Lab
Gene Symbol Ppp2r5a
Ensembl Gene ENSMUSG00000026626
Gene Nameprotein phosphatase 2, regulatory subunit B', alpha
Synonyms
MMRRC Submission 039676-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.207) question?
Stock #R1640 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location191351975-191403272 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 191353929 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 425 (M425V)
Ref Sequence ENSEMBL: ENSMUSP00000070726 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027940] [ENSMUST00000067976]
Predicted Effect probably benign
Transcript: ENSMUST00000027940
SMART Domains Protein: ENSMUSP00000027940
Gene: ENSMUSG00000026627

DomainStartEndE-ValueType
coiled coil region 2 36 N/A INTRINSIC
Pfam:TMEM206 55 349 7.2e-173 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000067976
AA Change: M425V

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000070726
Gene: ENSMUSG00000026626
AA Change: M425V

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
low complexity region 30 51 N/A INTRINSIC
Pfam:B56 56 462 3.6e-193 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191920
Predicted Effect probably benign
Transcript: ENSMUST00000191925
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195605
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 92.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the phosphatase 2A regulatory subunit B family. Protein phosphatase 2A is one of the four major Ser/Thr phosphatases, and it is implicated in the negative control of cell growth and division. It consists of a common heteromeric core enzyme, which is composed of a catalytic subunit and a constant regulatory subunit, that associates with a variety of regulatory subunits. The B regulatory subunit might modulate substrate selectivity and catalytic activity. This gene encodes an alpha isoform of the regulatory subunit B56 subfamily. Alternative transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Dec 2010]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810004N23Rik C A 8: 124,839,845 V279L probably damaging Het
4931417E11Rik A G 6: 73,468,886 Y227H probably benign Het
Acot6 A T 12: 84,101,126 Y52F probably damaging Het
Adam22 C T 5: 8,145,689 V284I probably damaging Het
Agl A T 3: 116,752,090 H1352Q probably benign Het
Aldh18a1 G A 19: 40,585,499 P27S probably benign Het
C1ra A G 6: 124,522,274 N473S probably benign Het
C87436 T C 6: 86,446,251 L269P probably damaging Het
Calcrl A G 2: 84,333,677 V390A probably damaging Het
Ccp110 T G 7: 118,715,528 probably null Het
Cerk A G 15: 86,149,400 V274A probably damaging Het
Chd1l A T 3: 97,580,991 S570T probably benign Het
Chst14 T A 2: 118,926,898 W83R probably damaging Het
Chsy1 A T 7: 66,171,514 D499V probably benign Het
Ckmt1 C A 2: 121,359,717 probably null Het
Cnot1 A T 8: 95,769,832 V282D probably damaging Het
Cntn3 A T 6: 102,242,013 S549T possibly damaging Het
Cntnap5c A T 17: 58,395,294 D1203V probably benign Het
Col4a4 A G 1: 82,535,770 Y169H unknown Het
Cwc22 A G 2: 77,915,530 F454S possibly damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dhrs7 A T 12: 72,652,315 W298R possibly damaging Het
Dock7 G T 4: 98,945,246 T1906N probably damaging Het
Dpy19l3 T C 7: 35,749,778 T67A probably benign Het
Drc1 A G 5: 30,363,957 D654G possibly damaging Het
Ech1 A T 7: 28,831,839 H284L probably damaging Het
Epc1 G A 18: 6,441,175 Q8* probably null Het
Etv5 A T 16: 22,435,914 D65E probably damaging Het
F2rl3 A G 8: 72,762,906 R254G probably benign Het
Fabp5 T G 3: 10,015,110 F73L probably benign Het
Fbrs T C 7: 127,487,311 I611T probably damaging Het
Flnc T C 6: 29,433,807 S117P possibly damaging Het
Frmd4b A C 6: 97,308,673 S291A possibly damaging Het
Galnt13 A G 2: 55,060,546 Y413C probably damaging Het
Gfer A G 17: 24,695,363 Y109H possibly damaging Het
Gli2 T C 1: 118,836,524 H1299R possibly damaging Het
Gm10110 T C 14: 89,898,243 noncoding transcript Het
Gprc5a T G 6: 135,078,654 L33W probably damaging Het
Grin3a T C 4: 49,844,721 T121A probably benign Het
Grk3 A G 5: 113,015,382 V33A probably benign Het
Hc A T 2: 35,057,324 Y59* probably null Het
Hrnr A G 3: 93,332,516 I3354V unknown Het
Hyou1 C G 9: 44,389,406 T924S probably benign Het
Ifi209 T G 1: 173,637,365 H20Q probably damaging Het
Ifi44 A G 3: 151,732,534 V372A probably benign Het
Igdcc4 T A 9: 65,122,795 L328H probably damaging Het
Kif18a A G 2: 109,289,816 T155A probably benign Het
Kmt2d A G 15: 98,845,057 probably benign Het
Kri1 T C 9: 21,280,457 D281G possibly damaging Het
Larp1b T A 3: 41,034,072 M1K probably null Het
Loxhd1 A G 18: 77,402,563 D1225G probably damaging Het
Mzf1 A G 7: 13,043,270 *736Q probably null Het
Naip2 C T 13: 100,161,981 A516T possibly damaging Het
Ncf2 T A 1: 152,808,033 M1K probably null Het
Olfr1095 T A 2: 86,851,227 H157L probably benign Het
Olfr1100 A C 2: 86,978,619 M59R probably damaging Het
Parp12 T C 6: 39,096,640 D417G probably benign Het
Parp12 T C 6: 39,111,678 H208R probably damaging Het
Pcif1 T C 2: 164,885,683 I132T probably benign Het
Pck2 A G 14: 55,548,584 D610G possibly damaging Het
Plbd1 T C 6: 136,640,125 K185E probably benign Het
Rapgef6 T A 11: 54,657,405 V805D probably damaging Het
Rprd2 C T 3: 95,763,747 probably benign Het
Ryr3 A G 2: 112,900,833 S711P probably damaging Het
Slc17a3 T A 13: 23,852,357 L212* probably null Het
Slc4a8 A G 15: 100,783,787 D41G probably benign Het
Slc9a3 T A 13: 74,158,818 V354E probably damaging Het
Spen A G 4: 141,468,943 I3632T probably damaging Het
Tesc A G 5: 118,054,849 S77G probably benign Het
Tet3 A T 6: 83,369,315 V1245D probably benign Het
Tox4 T A 14: 52,292,543 D553E possibly damaging Het
Tpmt A T 13: 47,027,283 Y193* probably null Het
Trio T C 15: 27,833,044 Y1169C probably damaging Het
Urb1 G A 16: 90,772,626 T1404I probably benign Het
Usp47 T C 7: 112,083,127 S540P probably damaging Het
Vmn1r178 A T 7: 23,894,123 M126L possibly damaging Het
Vmn1r223 T C 13: 23,250,178 F314S probably damaging Het
Vmn2r112 A T 17: 22,605,116 I451L probably benign Het
Zfc3h1 A G 10: 115,406,901 probably null Het
Zfp503 A T 14: 21,984,901 L649Q probably damaging Het
Zfp977 A C 7: 42,580,106 C332G probably damaging Het
Other mutations in Ppp2r5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03297:Ppp2r5a APN 1 191354762 missense probably benign 0.28
R3005:Ppp2r5a UTSW 1 191358976 missense probably damaging 1.00
R4810:Ppp2r5a UTSW 1 191356392 unclassified probably benign
R5730:Ppp2r5a UTSW 1 191372535 missense probably benign 0.04
R5769:Ppp2r5a UTSW 1 191372666 missense probably benign 0.02
R5783:Ppp2r5a UTSW 1 191354640 missense probably damaging 0.98
R6215:Ppp2r5a UTSW 1 191362250 missense probably benign 0.02
R7311:Ppp2r5a UTSW 1 191357801 missense probably damaging 1.00
R7485:Ppp2r5a UTSW 1 191396335 missense probably benign 0.07
R7545:Ppp2r5a UTSW 1 191372609 missense probably benign 0.00
V5622:Ppp2r5a UTSW 1 191358992 missense probably damaging 1.00
V5622:Ppp2r5a UTSW 1 191359001 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- GACAATGGCTGTAGTGCTCAGAGG -3'
(R):5'- AGACATGGCATTCAGACATTCCGAC -3'

Sequencing Primer
(F):5'- GGCTTCCAAATGATAATGCCTAAC -3'
(R):5'- CCCAGGGTCTAGGATGAGACTAC -3'
Posted On2014-04-24