Mutagenetix > Incidental Mutations

Incidental Mutation 'R1640:Cnot1'

173472

Institutional Source

Beutler Lab

Gene Symbol

Cnot1

Ensembl Gene

ENSMUSG00000036550

Gene Name

CCR4-NOT transcription complex, subunit 1

Synonyms

6030411K04Rik

MMRRC Submission

039676-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1640 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

95719451-95807464 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 95769832 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Aspartic acid at position 282 (V282D)

Ref Sequence

ENSEMBL: ENSMUSP00000096073 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000068452] [ENSMUST00000098473] [ENSMUST00000211887] [ENSMUST00000212323] [ENSMUST00000213006] [ENSMUST00000213046]

Predicted Effect

probably damaging
Transcript: ENSMUST00000068452
AA Change: V282D

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000063565
Gene: ENSMUSG00000036550
AA Change: V282D

Domain	Start	End	E-Value	Type
low complexity region	181	189	N/A	INTRINSIC
low complexity region	687	698	N/A	INTRINSIC
low complexity region	779	796	N/A	INTRINSIC
PDB:4J8S\|A	798	999	1e-137	PDB
low complexity region	1011	1028	N/A	INTRINSIC
low complexity region	1031	1055	N/A	INTRINSIC
PDB:4CT4\|C	1056	1295	1e-148	PDB
low complexity region	1296	1308	N/A	INTRINSIC
low complexity region	1328	1345	N/A	INTRINSIC
Pfam:DUF3819	1381	1530	2.5e-56	PFAM
low complexity region	1634	1648	N/A	INTRINSIC
Pfam:Not1	1991	2305	2.4e-125	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000098473
AA Change: V282D

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000096073
Gene: ENSMUSG00000036550
AA Change: V282D

Domain	Start	End	E-Value	Type
low complexity region	181	189	N/A	INTRINSIC
Pfam:CNOT1_HEAT	500	656	2.4e-57	PFAM
low complexity region	687	698	N/A	INTRINSIC
low complexity region	779	796	N/A	INTRINSIC
Pfam:CNOT1_TTP_bind	812	1004	1.4e-87	PFAM
low complexity region	1016	1033	N/A	INTRINSIC
low complexity region	1036	1060	N/A	INTRINSIC
Pfam:CNOT1_CAF1_bind	1087	1313	5.7e-99	PFAM
low complexity region	1333	1350	N/A	INTRINSIC
Pfam:DUF3819	1387	1534	2.3e-57	PFAM
low complexity region	1639	1653	N/A	INTRINSIC
Pfam:Not1	1998	2357	5.7e-157	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000211887
AA Change: V280D

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212228

Predicted Effect

probably benign
Transcript: ENSMUST00000212323

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212556

Predicted Effect

probably damaging
Transcript: ENSMUST00000213006
AA Change: V282D

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)

Predicted Effect

probably benign
Transcript: ENSMUST00000213046

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.1%
20x: 92.2%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice hmozygous for a conditional allele activated in cardiomyocytes exhibit postnatal lethality, decreased cardiac muscle contractility, prolonged QT interval and cardiac muscle cell death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810004N23Rik	C	A	8: 124,839,845	V279L	probably damaging	Het
4931417E11Rik	A	G	6: 73,468,886	Y227H	probably benign	Het
Acot6	A	T	12: 84,101,126	Y52F	probably damaging	Het
Adam22	C	T	5: 8,145,689	V284I	probably damaging	Het
Agl	A	T	3: 116,752,090	H1352Q	probably benign	Het
Aldh18a1	G	A	19: 40,585,499	P27S	probably benign	Het
C1ra	A	G	6: 124,522,274	N473S	probably benign	Het
C87436	T	C	6: 86,446,251	L269P	probably damaging	Het
Calcrl	A	G	2: 84,333,677	V390A	probably damaging	Het
Ccp110	T	G	7: 118,715,528		probably null	Het
Cerk	A	G	15: 86,149,400	V274A	probably damaging	Het
Chd1l	A	T	3: 97,580,991	S570T	probably benign	Het
Chst14	T	A	2: 118,926,898	W83R	probably damaging	Het
Chsy1	A	T	7: 66,171,514	D499V	probably benign	Het
Ckmt1	C	A	2: 121,359,717		probably null	Het
Cntn3	A	T	6: 102,242,013	S549T	possibly damaging	Het
Cntnap5c	A	T	17: 58,395,294	D1203V	probably benign	Het
Col4a4	A	G	1: 82,535,770	Y169H	unknown	Het
Cwc22	A	G	2: 77,915,530	F454S	possibly damaging	Het
Dab1	C	T	4: 104,731,751	A524V	probably benign	Het
Dhrs7	A	T	12: 72,652,315	W298R	possibly damaging	Het
Dock7	G	T	4: 98,945,246	T1906N	probably damaging	Het
Dpy19l3	T	C	7: 35,749,778	T67A	probably benign	Het
Drc1	A	G	5: 30,363,957	D654G	possibly damaging	Het
Ech1	A	T	7: 28,831,839	H284L	probably damaging	Het
Epc1	G	A	18: 6,441,175	Q8*	probably null	Het
Etv5	A	T	16: 22,435,914	D65E	probably damaging	Het
F2rl3	A	G	8: 72,762,906	R254G	probably benign	Het
Fabp5	T	G	3: 10,015,110	F73L	probably benign	Het
Fbrs	T	C	7: 127,487,311	I611T	probably damaging	Het
Flnc	T	C	6: 29,433,807	S117P	possibly damaging	Het
Frmd4b	A	C	6: 97,308,673	S291A	possibly damaging	Het
Galnt13	A	G	2: 55,060,546	Y413C	probably damaging	Het
Gfer	A	G	17: 24,695,363	Y109H	possibly damaging	Het
Gli2	T	C	1: 118,836,524	H1299R	possibly damaging	Het
Gm10110	T	C	14: 89,898,243		noncoding transcript	Het
Gprc5a	T	G	6: 135,078,654	L33W	probably damaging	Het
Grin3a	T	C	4: 49,844,721	T121A	probably benign	Het
Grk3	A	G	5: 113,015,382	V33A	probably benign	Het
Hc	A	T	2: 35,057,324	Y59*	probably null	Het
Hrnr	A	G	3: 93,332,516	I3354V	unknown	Het
Hyou1	C	G	9: 44,389,406	T924S	probably benign	Het
Ifi209	T	G	1: 173,637,365	H20Q	probably damaging	Het
Ifi44	A	G	3: 151,732,534	V372A	probably benign	Het
Igdcc4	T	A	9: 65,122,795	L328H	probably damaging	Het
Kif18a	A	G	2: 109,289,816	T155A	probably benign	Het
Kmt2d	A	G	15: 98,845,057		probably benign	Het
Kri1	T	C	9: 21,280,457	D281G	possibly damaging	Het
Larp1b	T	A	3: 41,034,072	M1K	probably null	Het
Loxhd1	A	G	18: 77,402,563	D1225G	probably damaging	Het
Mzf1	A	G	7: 13,043,270	*736Q	probably null	Het
Naip2	C	T	13: 100,161,981	A516T	possibly damaging	Het
Ncf2	T	A	1: 152,808,033	M1K	probably null	Het
Olfr1095	T	A	2: 86,851,227	H157L	probably benign	Het
Olfr1100	A	C	2: 86,978,619	M59R	probably damaging	Het
Parp12	T	C	6: 39,096,640	D417G	probably benign	Het
Parp12	T	C	6: 39,111,678	H208R	probably damaging	Het
Pcif1	T	C	2: 164,885,683	I132T	probably benign	Het
Pck2	A	G	14: 55,548,584	D610G	possibly damaging	Het
Plbd1	T	C	6: 136,640,125	K185E	probably benign	Het
Ppp2r5a	T	C	1: 191,353,929	M425V	probably damaging	Het
Rapgef6	T	A	11: 54,657,405	V805D	probably damaging	Het
Rprd2	C	T	3: 95,763,747		probably benign	Het
Ryr3	A	G	2: 112,900,833	S711P	probably damaging	Het
Slc17a3	T	A	13: 23,852,357	L212*	probably null	Het
Slc4a8	A	G	15: 100,783,787	D41G	probably benign	Het
Slc9a3	T	A	13: 74,158,818	V354E	probably damaging	Het
Spen	A	G	4: 141,468,943	I3632T	probably damaging	Het
Tesc	A	G	5: 118,054,849	S77G	probably benign	Het
Tet3	A	T	6: 83,369,315	V1245D	probably benign	Het
Tox4	T	A	14: 52,292,543	D553E	possibly damaging	Het
Tpmt	A	T	13: 47,027,283	Y193*	probably null	Het
Trio	T	C	15: 27,833,044	Y1169C	probably damaging	Het
Urb1	G	A	16: 90,772,626	T1404I	probably benign	Het
Usp47	T	C	7: 112,083,127	S540P	probably damaging	Het
Vmn1r178	A	T	7: 23,894,123	M126L	possibly damaging	Het
Vmn1r223	T	C	13: 23,250,178	F314S	probably damaging	Het
Vmn2r112	A	T	17: 22,605,116	I451L	probably benign	Het
Zfc3h1	A	G	10: 115,406,901		probably null	Het
Zfp503	A	T	14: 21,984,901	L649Q	probably damaging	Het
Zfp977	A	C	7: 42,580,106	C332G	probably damaging	Het

Other mutations in Cnot1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00516:Cnot1	APN	8	95726079	missense	probably damaging	1.00
IGL01340:Cnot1	APN	8	95760537	missense	probably damaging	1.00
IGL01457:Cnot1	APN	8	95741009	missense	probably damaging	1.00
IGL01505:Cnot1	APN	8	95728718	missense	probably damaging	0.98
IGL02401:Cnot1	APN	8	95756133	missense	possibly damaging	0.95
IGL02693:Cnot1	APN	8	95773485	missense	probably damaging	1.00
IGL02696:Cnot1	APN	8	95745017	missense	probably benign	0.00
IGL02754:Cnot1	APN	8	95755078	missense	probably benign	0.03
IGL03092:Cnot1	APN	8	95769615	intron	probably benign
IGL03174:Cnot1	APN	8	95761355	missense	probably damaging	1.00
IGL03310:Cnot1	APN	8	95735680	splice site	probably benign
IGL03371:Cnot1	APN	8	95774716	missense	possibly damaging	0.85
barge	UTSW	8	95734129	missense	probably benign	0.13
kowloon	UTSW	8	95788658	missense	probably damaging	1.00
tugboat	UTSW	8	95773618	missense	probably damaging	0.99
Xiao	UTSW	8	95730420	missense	probably damaging	1.00
R0008:Cnot1	UTSW	8	95761341	missense	probably damaging	1.00
R0008:Cnot1	UTSW	8	95761341	missense	probably damaging	1.00
R0091:Cnot1	UTSW	8	95763144	missense	probably damaging	1.00
R0335:Cnot1	UTSW	8	95772000	missense	probably benign	0.02
R0409:Cnot1	UTSW	8	95748855	missense	probably damaging	0.96
R0445:Cnot1	UTSW	8	95760208	missense	probably damaging	1.00
R1505:Cnot1	UTSW	8	95728667	missense	probably damaging	1.00
R1517:Cnot1	UTSW	8	95743213	missense	probably benign	0.38
R1737:Cnot1	UTSW	8	95748276	missense	probably damaging	0.98
R1755:Cnot1	UTSW	8	95724577	missense	probably damaging	1.00
R1901:Cnot1	UTSW	8	95743121	missense	possibly damaging	0.50
R1902:Cnot1	UTSW	8	95743121	missense	possibly damaging	0.50
R1903:Cnot1	UTSW	8	95743121	missense	possibly damaging	0.50
R1988:Cnot1	UTSW	8	95741944	missense	possibly damaging	0.89
R2051:Cnot1	UTSW	8	95724593	missense	possibly damaging	0.47
R2054:Cnot1	UTSW	8	95739841	missense	possibly damaging	0.55
R2072:Cnot1	UTSW	8	95739833	missense	possibly damaging	0.89
R2074:Cnot1	UTSW	8	95739833	missense	possibly damaging	0.89
R2075:Cnot1	UTSW	8	95739833	missense	possibly damaging	0.89
R2093:Cnot1	UTSW	8	95775358	missense	probably damaging	1.00
R2116:Cnot1	UTSW	8	95726153	missense	probably damaging	1.00
R2191:Cnot1	UTSW	8	95761426	missense	probably damaging	0.98
R2238:Cnot1	UTSW	8	95769521	missense	probably benign	0.04
R2239:Cnot1	UTSW	8	95769521	missense	probably benign	0.04
R2251:Cnot1	UTSW	8	95763186	missense	probably benign	0.00
R2252:Cnot1	UTSW	8	95763186	missense	probably benign	0.00
R2253:Cnot1	UTSW	8	95763186	missense	probably benign	0.00
R2315:Cnot1	UTSW	8	95749062	missense	probably damaging	1.00
R2431:Cnot1	UTSW	8	95774652	missense	probably damaging	1.00
R2988:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R2989:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R3108:Cnot1	UTSW	8	95735749	missense	probably damaging	0.99
R3109:Cnot1	UTSW	8	95735749	missense	probably damaging	0.99
R3114:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R3115:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R3153:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R3154:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R4112:Cnot1	UTSW	8	95773618	missense	probably damaging	0.99
R4359:Cnot1	UTSW	8	95739848	missense	probably damaging	1.00
R4382:Cnot1	UTSW	8	95769779	missense	probably damaging	0.97
R4747:Cnot1	UTSW	8	95774682	missense	probably benign	0.27
R4910:Cnot1	UTSW	8	95733231	missense	probably benign	0.43
R4913:Cnot1	UTSW	8	95763067	missense	possibly damaging	0.63
R4971:Cnot1	UTSW	8	95721626	missense	probably damaging	1.00
R5056:Cnot1	UTSW	8	95741008	missense	probably damaging	1.00
R5092:Cnot1	UTSW	8	95752768	missense	possibly damaging	0.91
R5101:Cnot1	UTSW	8	95760187	missense	possibly damaging	0.90
R5498:Cnot1	UTSW	8	95757355	missense	possibly damaging	0.92
R5719:Cnot1	UTSW	8	95744296	missense	possibly damaging	0.92
R5850:Cnot1	UTSW	8	95734147	nonsense	probably null
R5956:Cnot1	UTSW	8	95754978	critical splice donor site	probably null
R5981:Cnot1	UTSW	8	95788665	missense	probably damaging	1.00
R6093:Cnot1	UTSW	8	95748894	missense	probably benign	0.03
R6108:Cnot1	UTSW	8	95730420	missense	probably damaging	1.00
R6261:Cnot1	UTSW	8	95741921	missense	probably benign	0.00
R6632:Cnot1	UTSW	8	95773267	intron	probably benign
R6882:Cnot1	UTSW	8	95720426	missense	possibly damaging	0.85
R6966:Cnot1	UTSW	8	95724532	missense	probably damaging	1.00
R6985:Cnot1	UTSW	8	95734129	missense	probably benign	0.13
R7210:Cnot1	UTSW	8	95788658	missense	probably damaging	1.00
R7410:Cnot1	UTSW	8	95733159	missense	possibly damaging	0.77
R7623:Cnot1	UTSW	8	95727648	missense	probably damaging	1.00
R7624:Cnot1	UTSW	8	95751819	missense	probably damaging	1.00
R7695:Cnot1	UTSW	8	95770632	missense	probably benign	0.03
R7703:Cnot1	UTSW	8	95760098	critical splice donor site	probably null
R7771:Cnot1	UTSW	8	95765125	missense	probably damaging	0.99
R7800:Cnot1	UTSW	8	95765062	missense	probably benign	0.15
R7809:Cnot1	UTSW	8	95751778	missense	probably damaging	1.00
R7857:Cnot1	UTSW	8	95745647	frame shift	probably null
R7940:Cnot1	UTSW	8	95745647	frame shift	probably null
R8004:Cnot1	UTSW	8	95752752	missense	not run
R8061:Cnot1	UTSW	8	95765027	missense	not run
X0050:Cnot1	UTSW	8	95743098	splice site	probably null
Z1176:Cnot1	UTSW	8	95748277	missense	not run

Predicted Primers

PCR Primer
(F):5'- TGACGACAACTACTCACCAGCTCT -3'
(R):5'- TGCTTATGTGTATGCTCCAGTGCG -3'

Sequencing Primer
(F):5'- AGATCCCACTGCCAGGAG -3'
(R):5'- caccagaagagggtgtcag -3'

Posted On

2014-04-24