Incidental Mutation 'R1640:Dhrs7'
ID173482
Institutional Source Beutler Lab
Gene Symbol Dhrs7
Ensembl Gene ENSMUSG00000021094
Gene Namedehydrogenase/reductase (SDR family) member 7
SynonymsretSDR4, 2310016E22Rik, 5730564L20Rik, retDSR4
MMRRC Submission 039676-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R1640 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location72650353-72664909 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 72652315 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 298 (W298R)
Ref Sequence ENSEMBL: ENSMUSP00000021512 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021512] [ENSMUST00000208307] [ENSMUST00000220821]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021512
AA Change: W298R

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000021512
Gene: ENSMUSG00000021094
AA Change: W298R

DomainStartEndE-ValueType
transmembrane domain 5 22 N/A INTRINSIC
Pfam:KR 51 227 2.5e-11 PFAM
Pfam:adh_short 51 250 4.4e-52 PFAM
Pfam:adh_short_C2 57 267 1.3e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000208307
Predicted Effect probably benign
Transcript: ENSMUST00000220821
Predicted Effect unknown
Transcript: ENSMUST00000221750
AA Change: W321R
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 92.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the short-chain dehydrogenases/reductases (SDR) family, which has over 46,000 members. Members in this family are enzymes that metabolize many different compounds, such as steroid hormones, prostaglandins, retinoids, lipids and xenobiotics. [provided by RefSeq, Apr 2016]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810004N23Rik C A 8: 124,839,845 V279L probably damaging Het
4931417E11Rik A G 6: 73,468,886 Y227H probably benign Het
Acot6 A T 12: 84,101,126 Y52F probably damaging Het
Adam22 C T 5: 8,145,689 V284I probably damaging Het
Agl A T 3: 116,752,090 H1352Q probably benign Het
Aldh18a1 G A 19: 40,585,499 P27S probably benign Het
C1ra A G 6: 124,522,274 N473S probably benign Het
C87436 T C 6: 86,446,251 L269P probably damaging Het
Calcrl A G 2: 84,333,677 V390A probably damaging Het
Ccp110 T G 7: 118,715,528 probably null Het
Cerk A G 15: 86,149,400 V274A probably damaging Het
Chd1l A T 3: 97,580,991 S570T probably benign Het
Chst14 T A 2: 118,926,898 W83R probably damaging Het
Chsy1 A T 7: 66,171,514 D499V probably benign Het
Ckmt1 C A 2: 121,359,717 probably null Het
Cnot1 A T 8: 95,769,832 V282D probably damaging Het
Cntn3 A T 6: 102,242,013 S549T possibly damaging Het
Cntnap5c A T 17: 58,395,294 D1203V probably benign Het
Col4a4 A G 1: 82,535,770 Y169H unknown Het
Cwc22 A G 2: 77,915,530 F454S possibly damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dock7 G T 4: 98,945,246 T1906N probably damaging Het
Dpy19l3 T C 7: 35,749,778 T67A probably benign Het
Drc1 A G 5: 30,363,957 D654G possibly damaging Het
Ech1 A T 7: 28,831,839 H284L probably damaging Het
Epc1 G A 18: 6,441,175 Q8* probably null Het
Etv5 A T 16: 22,435,914 D65E probably damaging Het
F2rl3 A G 8: 72,762,906 R254G probably benign Het
Fabp5 T G 3: 10,015,110 F73L probably benign Het
Fbrs T C 7: 127,487,311 I611T probably damaging Het
Flnc T C 6: 29,433,807 S117P possibly damaging Het
Frmd4b A C 6: 97,308,673 S291A possibly damaging Het
Galnt13 A G 2: 55,060,546 Y413C probably damaging Het
Gfer A G 17: 24,695,363 Y109H possibly damaging Het
Gli2 T C 1: 118,836,524 H1299R possibly damaging Het
Gm10110 T C 14: 89,898,243 noncoding transcript Het
Gprc5a T G 6: 135,078,654 L33W probably damaging Het
Grin3a T C 4: 49,844,721 T121A probably benign Het
Grk3 A G 5: 113,015,382 V33A probably benign Het
Hc A T 2: 35,057,324 Y59* probably null Het
Hrnr A G 3: 93,332,516 I3354V unknown Het
Hyou1 C G 9: 44,389,406 T924S probably benign Het
Ifi209 T G 1: 173,637,365 H20Q probably damaging Het
Ifi44 A G 3: 151,732,534 V372A probably benign Het
Igdcc4 T A 9: 65,122,795 L328H probably damaging Het
Kif18a A G 2: 109,289,816 T155A probably benign Het
Kmt2d A G 15: 98,845,057 probably benign Het
Kri1 T C 9: 21,280,457 D281G possibly damaging Het
Larp1b T A 3: 41,034,072 M1K probably null Het
Loxhd1 A G 18: 77,402,563 D1225G probably damaging Het
Mzf1 A G 7: 13,043,270 *736Q probably null Het
Naip2 C T 13: 100,161,981 A516T possibly damaging Het
Ncf2 T A 1: 152,808,033 M1K probably null Het
Olfr1095 T A 2: 86,851,227 H157L probably benign Het
Olfr1100 A C 2: 86,978,619 M59R probably damaging Het
Parp12 T C 6: 39,096,640 D417G probably benign Het
Parp12 T C 6: 39,111,678 H208R probably damaging Het
Pcif1 T C 2: 164,885,683 I132T probably benign Het
Pck2 A G 14: 55,548,584 D610G possibly damaging Het
Plbd1 T C 6: 136,640,125 K185E probably benign Het
Ppp2r5a T C 1: 191,353,929 M425V probably damaging Het
Rapgef6 T A 11: 54,657,405 V805D probably damaging Het
Rprd2 C T 3: 95,763,747 probably benign Het
Ryr3 A G 2: 112,900,833 S711P probably damaging Het
Slc17a3 T A 13: 23,852,357 L212* probably null Het
Slc4a8 A G 15: 100,783,787 D41G probably benign Het
Slc9a3 T A 13: 74,158,818 V354E probably damaging Het
Spen A G 4: 141,468,943 I3632T probably damaging Het
Tesc A G 5: 118,054,849 S77G probably benign Het
Tet3 A T 6: 83,369,315 V1245D probably benign Het
Tox4 T A 14: 52,292,543 D553E possibly damaging Het
Tpmt A T 13: 47,027,283 Y193* probably null Het
Trio T C 15: 27,833,044 Y1169C probably damaging Het
Urb1 G A 16: 90,772,626 T1404I probably benign Het
Usp47 T C 7: 112,083,127 S540P probably damaging Het
Vmn1r178 A T 7: 23,894,123 M126L possibly damaging Het
Vmn1r223 T C 13: 23,250,178 F314S probably damaging Het
Vmn2r112 A T 17: 22,605,116 I451L probably benign Het
Zfc3h1 A G 10: 115,406,901 probably null Het
Zfp503 A T 14: 21,984,901 L649Q probably damaging Het
Zfp977 A C 7: 42,580,106 C332G probably damaging Het
Other mutations in Dhrs7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Dhrs7 APN 12 72659350 missense probably damaging 1.00
IGL00715:Dhrs7 APN 12 72652390 missense probably damaging 1.00
IGL02398:Dhrs7 APN 12 72664692 missense probably damaging 1.00
R0421:Dhrs7 UTSW 12 72653086 splice site probably benign
R0691:Dhrs7 UTSW 12 72652351 missense probably damaging 1.00
R1696:Dhrs7 UTSW 12 72653120 missense possibly damaging 0.88
R1727:Dhrs7 UTSW 12 72659464 missense probably damaging 1.00
R1791:Dhrs7 UTSW 12 72653165 missense probably benign 0.13
R2046:Dhrs7 UTSW 12 72652266 missense possibly damaging 0.47
R2124:Dhrs7 UTSW 12 72653177 missense probably damaging 1.00
R2205:Dhrs7 UTSW 12 72656370 missense probably damaging 1.00
R2356:Dhrs7 UTSW 12 72652381 missense probably benign 0.00
R3431:Dhrs7 UTSW 12 72664727 missense probably damaging 0.99
R4492:Dhrs7 UTSW 12 72653125 missense probably damaging 1.00
R4744:Dhrs7 UTSW 12 72652251 missense possibly damaging 0.94
R4747:Dhrs7 UTSW 12 72653118 missense probably benign 0.03
R5050:Dhrs7 UTSW 12 72657410 missense probably damaging 1.00
R5076:Dhrs7 UTSW 12 72659481 missense probably benign 0.00
R5678:Dhrs7 UTSW 12 72657332 missense probably damaging 1.00
R6361:Dhrs7 UTSW 12 72664659 missense probably damaging 0.98
R7895:Dhrs7 UTSW 12 72652460 splice site probably null
R8432:Dhrs7 UTSW 12 72664807 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GGTACAGAACCTGTTCTCCGTTCAC -3'
(R):5'- CATGAAACTGTCGGGACCTTCAGTG -3'

Sequencing Primer
(F):5'- TCGTGTGGAGTCAGAAAAACAAC -3'
(R):5'- TGTCGGGACCTTCAGTGTAAAAC -3'
Posted On2014-04-24