Incidental Mutation 'R1640:Urb1'
ID173500
Institutional Source Beutler Lab
Gene Symbol Urb1
Ensembl Gene ENSMUSG00000039929
Gene NameURB1 ribosome biogenesis 1 homolog (S. cerevisiae)
Synonyms4921511H13Rik, 5730405K23Rik
MMRRC Submission 039676-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1640 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location90751527-90810413 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 90772626 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 1404 (T1404I)
Ref Sequence ENSEMBL: ENSMUSP00000114717 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000140920]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140158
Predicted Effect probably benign
Transcript: ENSMUST00000140920
AA Change: T1404I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000114717
Gene: ENSMUSG00000039929
AA Change: T1404I

DomainStartEndE-ValueType
low complexity region 8 20 N/A INTRINSIC
Pfam:Npa1 78 396 1.5e-86 PFAM
low complexity region 751 761 N/A INTRINSIC
low complexity region 955 966 N/A INTRINSIC
low complexity region 1126 1137 N/A INTRINSIC
low complexity region 1360 1375 N/A INTRINSIC
Pfam:NopRA1 1670 1859 3.6e-60 PFAM
low complexity region 2029 2040 N/A INTRINSIC
low complexity region 2092 2111 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 92.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810004N23Rik C A 8: 124,839,845 V279L probably damaging Het
4931417E11Rik A G 6: 73,468,886 Y227H probably benign Het
Acot6 A T 12: 84,101,126 Y52F probably damaging Het
Adam22 C T 5: 8,145,689 V284I probably damaging Het
Agl A T 3: 116,752,090 H1352Q probably benign Het
Aldh18a1 G A 19: 40,585,499 P27S probably benign Het
C1ra A G 6: 124,522,274 N473S probably benign Het
C87436 T C 6: 86,446,251 L269P probably damaging Het
Calcrl A G 2: 84,333,677 V390A probably damaging Het
Ccp110 T G 7: 118,715,528 probably null Het
Cerk A G 15: 86,149,400 V274A probably damaging Het
Chd1l A T 3: 97,580,991 S570T probably benign Het
Chst14 T A 2: 118,926,898 W83R probably damaging Het
Chsy1 A T 7: 66,171,514 D499V probably benign Het
Ckmt1 C A 2: 121,359,717 probably null Het
Cnot1 A T 8: 95,769,832 V282D probably damaging Het
Cntn3 A T 6: 102,242,013 S549T possibly damaging Het
Cntnap5c A T 17: 58,395,294 D1203V probably benign Het
Col4a4 A G 1: 82,535,770 Y169H unknown Het
Cwc22 A G 2: 77,915,530 F454S possibly damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dhrs7 A T 12: 72,652,315 W298R possibly damaging Het
Dock7 G T 4: 98,945,246 T1906N probably damaging Het
Dpy19l3 T C 7: 35,749,778 T67A probably benign Het
Drc1 A G 5: 30,363,957 D654G possibly damaging Het
Ech1 A T 7: 28,831,839 H284L probably damaging Het
Epc1 G A 18: 6,441,175 Q8* probably null Het
Etv5 A T 16: 22,435,914 D65E probably damaging Het
F2rl3 A G 8: 72,762,906 R254G probably benign Het
Fabp5 T G 3: 10,015,110 F73L probably benign Het
Fbrs T C 7: 127,487,311 I611T probably damaging Het
Flnc T C 6: 29,433,807 S117P possibly damaging Het
Frmd4b A C 6: 97,308,673 S291A possibly damaging Het
Galnt13 A G 2: 55,060,546 Y413C probably damaging Het
Gfer A G 17: 24,695,363 Y109H possibly damaging Het
Gli2 T C 1: 118,836,524 H1299R possibly damaging Het
Gm10110 T C 14: 89,898,243 noncoding transcript Het
Gprc5a T G 6: 135,078,654 L33W probably damaging Het
Grin3a T C 4: 49,844,721 T121A probably benign Het
Grk3 A G 5: 113,015,382 V33A probably benign Het
Hc A T 2: 35,057,324 Y59* probably null Het
Hrnr A G 3: 93,332,516 I3354V unknown Het
Hyou1 C G 9: 44,389,406 T924S probably benign Het
Ifi209 T G 1: 173,637,365 H20Q probably damaging Het
Ifi44 A G 3: 151,732,534 V372A probably benign Het
Igdcc4 T A 9: 65,122,795 L328H probably damaging Het
Kif18a A G 2: 109,289,816 T155A probably benign Het
Kmt2d A G 15: 98,845,057 probably benign Het
Kri1 T C 9: 21,280,457 D281G possibly damaging Het
Larp1b T A 3: 41,034,072 M1K probably null Het
Loxhd1 A G 18: 77,402,563 D1225G probably damaging Het
Mzf1 A G 7: 13,043,270 *736Q probably null Het
Naip2 C T 13: 100,161,981 A516T possibly damaging Het
Ncf2 T A 1: 152,808,033 M1K probably null Het
Olfr1095 T A 2: 86,851,227 H157L probably benign Het
Olfr1100 A C 2: 86,978,619 M59R probably damaging Het
Parp12 T C 6: 39,096,640 D417G probably benign Het
Parp12 T C 6: 39,111,678 H208R probably damaging Het
Pcif1 T C 2: 164,885,683 I132T probably benign Het
Pck2 A G 14: 55,548,584 D610G possibly damaging Het
Plbd1 T C 6: 136,640,125 K185E probably benign Het
Ppp2r5a T C 1: 191,353,929 M425V probably damaging Het
Rapgef6 T A 11: 54,657,405 V805D probably damaging Het
Rprd2 C T 3: 95,763,747 probably benign Het
Ryr3 A G 2: 112,900,833 S711P probably damaging Het
Slc17a3 T A 13: 23,852,357 L212* probably null Het
Slc4a8 A G 15: 100,783,787 D41G probably benign Het
Slc9a3 T A 13: 74,158,818 V354E probably damaging Het
Spen A G 4: 141,468,943 I3632T probably damaging Het
Tesc A G 5: 118,054,849 S77G probably benign Het
Tet3 A T 6: 83,369,315 V1245D probably benign Het
Tox4 T A 14: 52,292,543 D553E possibly damaging Het
Tpmt A T 13: 47,027,283 Y193* probably null Het
Trio T C 15: 27,833,044 Y1169C probably damaging Het
Usp47 T C 7: 112,083,127 S540P probably damaging Het
Vmn1r178 A T 7: 23,894,123 M126L possibly damaging Het
Vmn1r223 T C 13: 23,250,178 F314S probably damaging Het
Vmn2r112 A T 17: 22,605,116 I451L probably benign Het
Zfc3h1 A G 10: 115,406,901 probably null Het
Zfp503 A T 14: 21,984,901 L649Q probably damaging Het
Zfp977 A C 7: 42,580,106 C332G probably damaging Het
Other mutations in Urb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00715:Urb1 APN 16 90753321 critical splice donor site probably null
IGL00915:Urb1 APN 16 90779098 missense possibly damaging 0.76
IGL01108:Urb1 APN 16 90792814 missense probably damaging 1.00
IGL01122:Urb1 APN 16 90804458 missense possibly damaging 0.81
IGL01387:Urb1 APN 16 90757761 missense possibly damaging 0.64
IGL01484:Urb1 APN 16 90777560 missense probably benign 0.11
IGL01606:Urb1 APN 16 90760459 missense probably damaging 1.00
IGL01989:Urb1 APN 16 90769586 splice site probably benign
IGL02516:Urb1 APN 16 90772695 missense possibly damaging 0.49
IGL03018:Urb1 APN 16 90788156 missense probably benign 0.02
IGL03165:Urb1 APN 16 90780304 missense probably damaging 1.00
IGL03216:Urb1 APN 16 90788114 missense probably benign 0.00
H8562:Urb1 UTSW 16 90769469 missense probably benign 0.08
H8786:Urb1 UTSW 16 90769469 missense probably benign 0.08
R0064:Urb1 UTSW 16 90779140 missense probably benign
R0064:Urb1 UTSW 16 90779140 missense probably benign
R0359:Urb1 UTSW 16 90791160 missense probably damaging 1.00
R0386:Urb1 UTSW 16 90796399 missense probably damaging 1.00
R0508:Urb1 UTSW 16 90783262 splice site probably benign
R0517:Urb1 UTSW 16 90777422 nonsense probably null
R0704:Urb1 UTSW 16 90776207 missense probably benign 0.31
R0755:Urb1 UTSW 16 90774094 missense probably damaging 1.00
R0755:Urb1 UTSW 16 90779138 missense probably benign
R0783:Urb1 UTSW 16 90810297 missense possibly damaging 0.55
R0833:Urb1 UTSW 16 90795448 missense possibly damaging 0.89
R0836:Urb1 UTSW 16 90795448 missense possibly damaging 0.89
R0970:Urb1 UTSW 16 90769447 missense possibly damaging 0.83
R1144:Urb1 UTSW 16 90776318 splice site probably null
R1344:Urb1 UTSW 16 90769466 missense probably damaging 1.00
R1418:Urb1 UTSW 16 90769466 missense probably damaging 1.00
R1453:Urb1 UTSW 16 90796492 missense probably damaging 1.00
R1470:Urb1 UTSW 16 90752014 missense probably benign 0.34
R1470:Urb1 UTSW 16 90752014 missense probably benign 0.34
R1520:Urb1 UTSW 16 90774745 missense probably benign 0.00
R1521:Urb1 UTSW 16 90753863 missense probably damaging 1.00
R1598:Urb1 UTSW 16 90777440 missense possibly damaging 0.93
R1617:Urb1 UTSW 16 90760452 missense possibly damaging 0.82
R1625:Urb1 UTSW 16 90774048 critical splice donor site probably null
R1664:Urb1 UTSW 16 90788082 critical splice donor site probably null
R1672:Urb1 UTSW 16 90787397 missense probably damaging 1.00
R1694:Urb1 UTSW 16 90767040 missense probably benign
R1856:Urb1 UTSW 16 90761695 missense probably benign 0.00
R2001:Urb1 UTSW 16 90762344 missense probably benign 0.30
R2196:Urb1 UTSW 16 90774256 missense probably benign 0.01
R2850:Urb1 UTSW 16 90774256 missense probably benign 0.01
R3009:Urb1 UTSW 16 90774798 missense probably benign 0.09
R3104:Urb1 UTSW 16 90795443 missense probably damaging 1.00
R3105:Urb1 UTSW 16 90795443 missense probably damaging 1.00
R3106:Urb1 UTSW 16 90795443 missense probably damaging 1.00
R3160:Urb1 UTSW 16 90797903 missense probably damaging 1.00
R3162:Urb1 UTSW 16 90797903 missense probably damaging 1.00
R3900:Urb1 UTSW 16 90783376 missense possibly damaging 0.86
R4014:Urb1 UTSW 16 90769465 missense probably damaging 1.00
R4036:Urb1 UTSW 16 90788086 missense probably benign
R4332:Urb1 UTSW 16 90774537 missense probably damaging 1.00
R4448:Urb1 UTSW 16 90769394 missense possibly damaging 0.71
R4581:Urb1 UTSW 16 90788146 missense probably benign 0.04
R4593:Urb1 UTSW 16 90787444 missense probably damaging 1.00
R4610:Urb1 UTSW 16 90776271 missense probably benign 0.43
R4659:Urb1 UTSW 16 90776129 missense probably damaging 0.96
R4672:Urb1 UTSW 16 90772634 missense probably benign
R4681:Urb1 UTSW 16 90804537 missense probably damaging 0.99
R4771:Urb1 UTSW 16 90753518 missense probably benign 0.00
R4790:Urb1 UTSW 16 90769555 nonsense probably null
R4798:Urb1 UTSW 16 90757827 missense probably benign 0.12
R4809:Urb1 UTSW 16 90759842 missense possibly damaging 0.82
R4850:Urb1 UTSW 16 90795414 nonsense probably null
R4916:Urb1 UTSW 16 90783328 missense probably damaging 1.00
R4969:Urb1 UTSW 16 90805411 missense probably damaging 1.00
R5032:Urb1 UTSW 16 90756171 missense probably benign 0.00
R5111:Urb1 UTSW 16 90752017 missense probably benign 0.00
R5122:Urb1 UTSW 16 90752095 nonsense probably null
R5184:Urb1 UTSW 16 90783274 critical splice donor site probably null
R5199:Urb1 UTSW 16 90792748 missense possibly damaging 0.95
R5436:Urb1 UTSW 16 90792762 missense probably damaging 1.00
R5767:Urb1 UTSW 16 90776163 missense probably benign 0.00
R5812:Urb1 UTSW 16 90804537 missense probably damaging 0.99
R5872:Urb1 UTSW 16 90772764 nonsense probably null
R6052:Urb1 UTSW 16 90762383 missense probably damaging 1.00
R6063:Urb1 UTSW 16 90789097 missense probably benign 0.02
R6065:Urb1 UTSW 16 90803332 missense probably benign 0.03
R6181:Urb1 UTSW 16 90779094 missense probably benign 0.00
R6268:Urb1 UTSW 16 90753919 missense probably benign 0.03
R6429:Urb1 UTSW 16 90762430 splice site probably null
R6572:Urb1 UTSW 16 90787414 missense probably benign 0.37
R6606:Urb1 UTSW 16 90810268 missense probably benign 0.00
R6730:Urb1 UTSW 16 90779083 missense possibly damaging 0.89
R6838:Urb1 UTSW 16 90782106 missense possibly damaging 0.93
R7237:Urb1 UTSW 16 90791166 missense probably damaging 1.00
R7238:Urb1 UTSW 16 90752115 missense possibly damaging 0.88
R7339:Urb1 UTSW 16 90772573 critical splice donor site probably benign
R7341:Urb1 UTSW 16 90772573 critical splice donor site probably benign
R7361:Urb1 UTSW 16 90774768 missense probably damaging 0.99
R7365:Urb1 UTSW 16 90772573 critical splice donor site probably benign
R7366:Urb1 UTSW 16 90772573 critical splice donor site probably benign
R7440:Urb1 UTSW 16 90787408 missense probably damaging 1.00
R7530:Urb1 UTSW 16 90761634 missense probably damaging 1.00
R7553:Urb1 UTSW 16 90792864 missense probably damaging 1.00
R7557:Urb1 UTSW 16 90772573 critical splice donor site probably benign
R7603:Urb1 UTSW 16 90772573 critical splice donor site probably benign
R7607:Urb1 UTSW 16 90772573 critical splice donor site probably benign
R7609:Urb1 UTSW 16 90772573 critical splice donor site probably benign
R7610:Urb1 UTSW 16 90772573 critical splice donor site probably benign
R7612:Urb1 UTSW 16 90797910 missense probably damaging 1.00
R7613:Urb1 UTSW 16 90772573 critical splice donor site probably benign
R7684:Urb1 UTSW 16 90786118 nonsense probably null
R8029:Urb1 UTSW 16 90779152 missense possibly damaging 0.67
Z1177:Urb1 UTSW 16 90753883 missense probably benign 0.00
Z1177:Urb1 UTSW 16 90774862 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TCCAACAAAGCTTGCTACTGTCACC -3'
(R):5'- TAGTGCAAGTCTCTGCACACAGCC -3'

Sequencing Primer
(F):5'- TTTTACTAGGAGGTCAGCACCAC -3'
(R):5'- ACAGCCCTTAGTTAGCAGTG -3'
Posted On2014-04-24