Incidental Mutation 'R1640:Loxhd1'
ID173505
Institutional Source Beutler Lab
Gene Symbol Loxhd1
Ensembl Gene ENSMUSG00000032818
Gene Namelipoxygenase homology domains 1
Synonymssba, 1700096C21Rik
MMRRC Submission 039676-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.193) question?
Stock #R1640 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location77281958-77442341 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 77402563 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1225 (D1225G)
Ref Sequence ENSEMBL: ENSMUSP00000114988 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096547] [ENSMUST00000123410] [ENSMUST00000148341]
Predicted Effect possibly damaging
Transcript: ENSMUST00000096547
AA Change: D1334G

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000094294
Gene: ENSMUSG00000032818
AA Change: D1334G

DomainStartEndE-ValueType
LH2 43 158 5.64e-5 SMART
LH2 172 290 1.64e-9 SMART
LH2 296 409 1.1e-4 SMART
LH2 425 539 4.02e-4 SMART
LH2 553 675 3.79e-6 SMART
LH2 684 800 5.92e-6 SMART
LH2 814 936 6.91e-8 SMART
low complexity region 945 954 N/A INTRINSIC
LH2 970 1086 4.81e-7 SMART
LH2 1101 1228 5.73e-3 SMART
LH2 1255 1375 8.82e-5 SMART
Pfam:PLAT 1424 1540 5.4e-10 PFAM
LH2 1553 1666 6.41e-3 SMART
LH2 1680 1799 6.76e-6 SMART
Pfam:PLAT 1813 1929 3.8e-9 PFAM
LH2 1949 2067 7.23e-11 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000123410
AA Change: D468G

PolyPhen 2 Score 0.803 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000120991
Gene: ENSMUSG00000032818
AA Change: D468G

DomainStartEndE-ValueType
Pfam:PLAT 1 67 4.4e-15 PFAM
low complexity region 79 88 N/A INTRINSIC
LH2 104 220 4.81e-7 SMART
LH2 235 362 5.73e-3 SMART
LH2 389 509 8.82e-5 SMART
Pfam:PLAT 558 674 9.9e-12 PFAM
LH2 687 800 6.41e-3 SMART
LH2 814 933 6.76e-6 SMART
Pfam:PLAT 947 1065 8.8e-9 PFAM
Pfam:PLAT 1085 1174 4.2e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000148341
AA Change: D1225G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000114988
Gene: ENSMUSG00000032818
AA Change: D1225G

DomainStartEndE-ValueType
Pfam:PLAT 1 91 1.7e-11 PFAM
LH2 106 220 4.02e-4 SMART
LH2 234 356 3.79e-6 SMART
LH2 365 481 5.92e-6 SMART
LH2 495 610 7.67e-3 SMART
LH2 707 827 1.47e-11 SMART
low complexity region 836 845 N/A INTRINSIC
LH2 861 977 4.81e-7 SMART
LH2 992 1119 5.73e-3 SMART
LH2 1146 1266 8.82e-5 SMART
Pfam:PLAT 1384 1469 8.9e-14 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 92.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice honozygous for an ENU-induced mutation exhibit hearing loss associated with hair cell and spiral ganglion degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810004N23Rik C A 8: 124,839,845 V279L probably damaging Het
4931417E11Rik A G 6: 73,468,886 Y227H probably benign Het
Acot6 A T 12: 84,101,126 Y52F probably damaging Het
Adam22 C T 5: 8,145,689 V284I probably damaging Het
Agl A T 3: 116,752,090 H1352Q probably benign Het
Aldh18a1 G A 19: 40,585,499 P27S probably benign Het
C1ra A G 6: 124,522,274 N473S probably benign Het
C87436 T C 6: 86,446,251 L269P probably damaging Het
Calcrl A G 2: 84,333,677 V390A probably damaging Het
Ccp110 T G 7: 118,715,528 probably null Het
Cerk A G 15: 86,149,400 V274A probably damaging Het
Chd1l A T 3: 97,580,991 S570T probably benign Het
Chst14 T A 2: 118,926,898 W83R probably damaging Het
Chsy1 A T 7: 66,171,514 D499V probably benign Het
Ckmt1 C A 2: 121,359,717 probably null Het
Cnot1 A T 8: 95,769,832 V282D probably damaging Het
Cntn3 A T 6: 102,242,013 S549T possibly damaging Het
Cntnap5c A T 17: 58,395,294 D1203V probably benign Het
Col4a4 A G 1: 82,535,770 Y169H unknown Het
Cwc22 A G 2: 77,915,530 F454S possibly damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dhrs7 A T 12: 72,652,315 W298R possibly damaging Het
Dock7 G T 4: 98,945,246 T1906N probably damaging Het
Dpy19l3 T C 7: 35,749,778 T67A probably benign Het
Drc1 A G 5: 30,363,957 D654G possibly damaging Het
Ech1 A T 7: 28,831,839 H284L probably damaging Het
Epc1 G A 18: 6,441,175 Q8* probably null Het
Etv5 A T 16: 22,435,914 D65E probably damaging Het
F2rl3 A G 8: 72,762,906 R254G probably benign Het
Fabp5 T G 3: 10,015,110 F73L probably benign Het
Fbrs T C 7: 127,487,311 I611T probably damaging Het
Flnc T C 6: 29,433,807 S117P possibly damaging Het
Frmd4b A C 6: 97,308,673 S291A possibly damaging Het
Galnt13 A G 2: 55,060,546 Y413C probably damaging Het
Gfer A G 17: 24,695,363 Y109H possibly damaging Het
Gli2 T C 1: 118,836,524 H1299R possibly damaging Het
Gm10110 T C 14: 89,898,243 noncoding transcript Het
Gprc5a T G 6: 135,078,654 L33W probably damaging Het
Grin3a T C 4: 49,844,721 T121A probably benign Het
Grk3 A G 5: 113,015,382 V33A probably benign Het
Hc A T 2: 35,057,324 Y59* probably null Het
Hrnr A G 3: 93,332,516 I3354V unknown Het
Hyou1 C G 9: 44,389,406 T924S probably benign Het
Ifi209 T G 1: 173,637,365 H20Q probably damaging Het
Ifi44 A G 3: 151,732,534 V372A probably benign Het
Igdcc4 T A 9: 65,122,795 L328H probably damaging Het
Kif18a A G 2: 109,289,816 T155A probably benign Het
Kmt2d A G 15: 98,845,057 probably benign Het
Kri1 T C 9: 21,280,457 D281G possibly damaging Het
Larp1b T A 3: 41,034,072 M1K probably null Het
Mzf1 A G 7: 13,043,270 *736Q probably null Het
Naip2 C T 13: 100,161,981 A516T possibly damaging Het
Ncf2 T A 1: 152,808,033 M1K probably null Het
Olfr1095 T A 2: 86,851,227 H157L probably benign Het
Olfr1100 A C 2: 86,978,619 M59R probably damaging Het
Parp12 T C 6: 39,096,640 D417G probably benign Het
Parp12 T C 6: 39,111,678 H208R probably damaging Het
Pcif1 T C 2: 164,885,683 I132T probably benign Het
Pck2 A G 14: 55,548,584 D610G possibly damaging Het
Plbd1 T C 6: 136,640,125 K185E probably benign Het
Ppp2r5a T C 1: 191,353,929 M425V probably damaging Het
Rapgef6 T A 11: 54,657,405 V805D probably damaging Het
Rprd2 C T 3: 95,763,747 probably benign Het
Ryr3 A G 2: 112,900,833 S711P probably damaging Het
Slc17a3 T A 13: 23,852,357 L212* probably null Het
Slc4a8 A G 15: 100,783,787 D41G probably benign Het
Slc9a3 T A 13: 74,158,818 V354E probably damaging Het
Spen A G 4: 141,468,943 I3632T probably damaging Het
Tesc A G 5: 118,054,849 S77G probably benign Het
Tet3 A T 6: 83,369,315 V1245D probably benign Het
Tox4 T A 14: 52,292,543 D553E possibly damaging Het
Tpmt A T 13: 47,027,283 Y193* probably null Het
Trio T C 15: 27,833,044 Y1169C probably damaging Het
Urb1 G A 16: 90,772,626 T1404I probably benign Het
Usp47 T C 7: 112,083,127 S540P probably damaging Het
Vmn1r178 A T 7: 23,894,123 M126L possibly damaging Het
Vmn1r223 T C 13: 23,250,178 F314S probably damaging Het
Vmn2r112 A T 17: 22,605,116 I451L probably benign Het
Zfc3h1 A G 10: 115,406,901 probably null Het
Zfp503 A T 14: 21,984,901 L649Q probably damaging Het
Zfp977 A C 7: 42,580,106 C332G probably damaging Het
Other mutations in Loxhd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Loxhd1 APN 18 77395450 missense probably damaging 0.99
IGL00490:Loxhd1 APN 18 77431074 missense possibly damaging 0.94
IGL00507:Loxhd1 APN 18 77332567 missense probably benign 0.03
IGL00546:Loxhd1 APN 18 77405976 missense probably damaging 0.97
IGL01369:Loxhd1 APN 18 77329201 missense possibly damaging 0.85
IGL01767:Loxhd1 APN 18 77286424 missense possibly damaging 0.71
IGL02245:Loxhd1 APN 18 77340101 missense possibly damaging 0.71
IGL02388:Loxhd1 APN 18 77369137 missense probably benign 0.18
IGL02410:Loxhd1 APN 18 77402952 missense probably benign 0.02
IGL02593:Loxhd1 APN 18 77410539 missense possibly damaging 0.91
IGL02632:Loxhd1 APN 18 77405932 missense probably damaging 0.99
IGL02692:Loxhd1 APN 18 77356913 missense probably damaging 0.99
IGL02796:Loxhd1 APN 18 77369115 splice site probably benign
IGL03032:Loxhd1 APN 18 77286473 missense possibly damaging 0.93
IGL03074:Loxhd1 APN 18 77441784 missense possibly damaging 0.75
IGL03094:Loxhd1 APN 18 77431113 missense possibly damaging 0.88
IGL03118:Loxhd1 APN 18 77380464 missense probably damaging 1.00
IGL03232:Loxhd1 APN 18 77408750 missense probably damaging 1.00
IGL03377:Loxhd1 APN 18 77441673 missense possibly damaging 0.91
H8562:Loxhd1 UTSW 18 77341931 missense possibly damaging 0.93
PIT4494001:Loxhd1 UTSW 18 77441768 missense probably damaging 0.99
R0003:Loxhd1 UTSW 18 77339500 missense probably damaging 0.98
R0003:Loxhd1 UTSW 18 77339500 missense probably damaging 0.98
R0048:Loxhd1 UTSW 18 77408778 missense probably damaging 0.99
R0049:Loxhd1 UTSW 18 77380560 splice site probably benign
R0049:Loxhd1 UTSW 18 77380560 splice site probably benign
R0206:Loxhd1 UTSW 18 77404866 missense possibly damaging 0.90
R0206:Loxhd1 UTSW 18 77404866 missense possibly damaging 0.90
R0208:Loxhd1 UTSW 18 77404866 missense possibly damaging 0.90
R0323:Loxhd1 UTSW 18 77369137 missense probably benign 0.18
R0332:Loxhd1 UTSW 18 77383830 synonymous probably null
R0367:Loxhd1 UTSW 18 77425757 splice site probably benign
R0709:Loxhd1 UTSW 18 77404969 missense probably benign 0.23
R0783:Loxhd1 UTSW 18 77429984 missense possibly damaging 0.58
R1132:Loxhd1 UTSW 18 77429943 missense possibly damaging 0.71
R1232:Loxhd1 UTSW 18 77406003 critical splice donor site probably null
R1331:Loxhd1 UTSW 18 77402936 missense possibly damaging 0.86
R1465:Loxhd1 UTSW 18 77380573 intron probably null
R1465:Loxhd1 UTSW 18 77380573 intron probably null
R1501:Loxhd1 UTSW 18 77356832 missense probably damaging 1.00
R1656:Loxhd1 UTSW 18 77321668 missense possibly damaging 0.71
R1671:Loxhd1 UTSW 18 77404802 missense probably damaging 1.00
R1725:Loxhd1 UTSW 18 77293241 missense probably benign 0.32
R1735:Loxhd1 UTSW 18 77404889 missense probably damaging 0.98
R1796:Loxhd1 UTSW 18 77405907 missense probably damaging 0.96
R1796:Loxhd1 UTSW 18 77425639 missense possibly damaging 0.88
R1800:Loxhd1 UTSW 18 77402502 missense probably damaging 1.00
R1848:Loxhd1 UTSW 18 77281971 missense possibly damaging 0.53
R1912:Loxhd1 UTSW 18 77340137 missense probably benign 0.32
R1945:Loxhd1 UTSW 18 77404808 missense probably damaging 1.00
R1978:Loxhd1 UTSW 18 77321642 missense possibly damaging 0.86
R1997:Loxhd1 UTSW 18 77295769 missense probably damaging 0.98
R2086:Loxhd1 UTSW 18 77384946 missense probably damaging 1.00
R2153:Loxhd1 UTSW 18 77356166 missense possibly damaging 0.72
R3124:Loxhd1 UTSW 18 77431078 missense probably damaging 0.97
R3896:Loxhd1 UTSW 18 77382023 missense possibly damaging 0.65
R3907:Loxhd1 UTSW 18 77408768 missense possibly damaging 0.60
R3980:Loxhd1 UTSW 18 77414159 missense probably damaging 1.00
R4165:Loxhd1 UTSW 18 77372329 missense probably damaging 0.99
R4166:Loxhd1 UTSW 18 77372329 missense probably damaging 0.99
R4176:Loxhd1 UTSW 18 77331059 missense possibly damaging 0.53
R4345:Loxhd1 UTSW 18 77399001 missense possibly damaging 0.89
R4354:Loxhd1 UTSW 18 77395427 missense probably damaging 1.00
R4385:Loxhd1 UTSW 18 77372911 missense probably damaging 0.99
R4402:Loxhd1 UTSW 18 77441760 missense possibly damaging 0.94
R4404:Loxhd1 UTSW 18 77431132 missense probably damaging 1.00
R4456:Loxhd1 UTSW 18 77399089 missense probably damaging 1.00
R4525:Loxhd1 UTSW 18 77356912 missense probably damaging 0.98
R4605:Loxhd1 UTSW 18 77405946 missense probably benign 0.00
R4661:Loxhd1 UTSW 18 77402885 missense possibly damaging 0.79
R4698:Loxhd1 UTSW 18 77372291 missense possibly damaging 0.82
R4725:Loxhd1 UTSW 18 77395457 missense probably damaging 1.00
R4820:Loxhd1 UTSW 18 77384967 missense probably damaging 1.00
R5163:Loxhd1 UTSW 18 77361736 missense possibly damaging 0.92
R5288:Loxhd1 UTSW 18 77363612 missense probably damaging 1.00
R5328:Loxhd1 UTSW 18 77410572 missense probably damaging 1.00
R5329:Loxhd1 UTSW 18 77332682 missense probably damaging 0.98
R5347:Loxhd1 UTSW 18 77366541 missense probably damaging 1.00
R5589:Loxhd1 UTSW 18 77342055 missense possibly damaging 0.86
R5616:Loxhd1 UTSW 18 77404951 missense probably damaging 1.00
R5703:Loxhd1 UTSW 18 77356877 missense probably damaging 1.00
R5837:Loxhd1 UTSW 18 77286409 missense possibly damaging 0.71
R5888:Loxhd1 UTSW 18 77402515 missense probably damaging 0.99
R6021:Loxhd1 UTSW 18 77412250 missense probably damaging 1.00
R6032:Loxhd1 UTSW 18 77381558 missense probably damaging 1.00
R6032:Loxhd1 UTSW 18 77381558 missense probably damaging 1.00
R6153:Loxhd1 UTSW 18 77295758 missense possibly damaging 0.71
R6174:Loxhd1 UTSW 18 77412178 missense probably damaging 1.00
R6265:Loxhd1 UTSW 18 77361730 missense probably damaging 0.99
R6377:Loxhd1 UTSW 18 77380432 missense probably damaging 1.00
R6530:Loxhd1 UTSW 18 77412151 missense probably benign 0.30
R6555:Loxhd1 UTSW 18 77293269 missense possibly damaging 0.51
R6782:Loxhd1 UTSW 18 77431177 missense probably damaging 0.99
R6834:Loxhd1 UTSW 18 77441526 missense probably damaging 1.00
R7000:Loxhd1 UTSW 18 77372433 critical splice donor site probably null
R7112:Loxhd1 UTSW 18 77388514 missense probably damaging 1.00
R7203:Loxhd1 UTSW 18 77414196 missense probably damaging 0.97
R7206:Loxhd1 UTSW 18 77441817 missense probably damaging 0.97
R7260:Loxhd1 UTSW 18 77332642 missense possibly damaging 0.93
R7432:Loxhd1 UTSW 18 77295851 missense possibly damaging 0.51
R7475:Loxhd1 UTSW 18 77412305 missense possibly damaging 0.83
R7555:Loxhd1 UTSW 18 77395365 missense probably damaging 0.99
R7590:Loxhd1 UTSW 18 77321634 missense possibly damaging 0.84
R7612:Loxhd1 UTSW 18 77429975 missense possibly damaging 0.95
R7626:Loxhd1 UTSW 18 77431186 missense possibly damaging 0.75
R7768:Loxhd1 UTSW 18 77384941 missense probably damaging 0.99
R7791:Loxhd1 UTSW 18 77383729 missense probably damaging 1.00
R7829:Loxhd1 UTSW 18 77408787 missense probably damaging 0.99
R7884:Loxhd1 UTSW 18 77431213 missense probably damaging 0.98
R7967:Loxhd1 UTSW 18 77431213 missense probably damaging 0.98
R8042:Loxhd1 UTSW 18 77431192 missense probably damaging 0.99
X0020:Loxhd1 UTSW 18 77339562 nonsense probably null
X0024:Loxhd1 UTSW 18 77395403 missense probably damaging 1.00
X0062:Loxhd1 UTSW 18 77441516 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCTCATTCACACTGAACAGAGCC -3'
(R):5'- TGACATCTGCTCCAAGGATCTCCC -3'

Sequencing Primer
(F):5'- TCACGAAGCAGTGTCCTACG -3'
(R):5'- CCCTTGAGTGTAAAGATGCCTAC -3'
Posted On2014-04-24