Incidental Mutation 'R1641:Aasdh'
ID 173528
Institutional Source Beutler Lab
Gene Symbol Aasdh
Ensembl Gene ENSMUSG00000055923
Gene Name aminoadipate-semialdehyde dehydrogenase
Synonyms A230062G08Rik
MMRRC Submission 039677-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.159) question?
Stock # R1641 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 77021506-77053361 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 77039626 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 228 (T228S)
Ref Sequence ENSEMBL: ENSMUSP00000117639 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069709] [ENSMUST00000120963] [ENSMUST00000123682] [ENSMUST00000126741] [ENSMUST00000146570]
AlphaFold Q80WC9
Predicted Effect probably benign
Transcript: ENSMUST00000069709
AA Change: T228S

PolyPhen 2 Score 0.272 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000069279
Gene: ENSMUSG00000055923
AA Change: T228S

DomainStartEndE-ValueType
Pfam:AMP-binding 7 449 1.3e-50 PFAM
Pfam:AMP-binding_C 458 526 7.4e-6 PFAM
Pfam:PP-binding 556 628 1.2e-6 PFAM
PQQ 775 808 5.29e-1 SMART
PQQ 818 850 4.37e-2 SMART
PQQ 860 892 2.3e1 SMART
PQQ 901 934 2.83e1 SMART
Blast:PQQ 943 973 2e-9 BLAST
PQQ 982 1014 2.61e2 SMART
PQQ 1029 1061 8.53e0 SMART
Blast:PQQ 1070 1100 2e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000120963
AA Change: T228S

PolyPhen 2 Score 0.272 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000113792
Gene: ENSMUSG00000055923
AA Change: T228S

DomainStartEndE-ValueType
Pfam:AMP-binding 7 449 1.3e-50 PFAM
Pfam:AMP-binding_C 458 526 7.4e-6 PFAM
Pfam:PP-binding 556 628 1.2e-6 PFAM
PQQ 775 808 5.29e-1 SMART
PQQ 818 850 4.37e-2 SMART
PQQ 860 892 2.3e1 SMART
PQQ 901 934 2.83e1 SMART
Blast:PQQ 943 973 2e-9 BLAST
PQQ 982 1014 2.61e2 SMART
PQQ 1029 1061 8.53e0 SMART
Blast:PQQ 1070 1100 2e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000123682
SMART Domains Protein: ENSMUSP00000121050
Gene: ENSMUSG00000055923

DomainStartEndE-ValueType
Pfam:AMP-binding 7 231 1.7e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126741
AA Change: T228S

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000118854
Gene: ENSMUSG00000055923
AA Change: T228S

DomainStartEndE-ValueType
Pfam:AMP-binding 7 403 7.5e-51 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135697
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136080
Predicted Effect probably benign
Transcript: ENSMUST00000146570
AA Change: T228S

PolyPhen 2 Score 0.361 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000117639
Gene: ENSMUSG00000055923
AA Change: T228S

DomainStartEndE-ValueType
Pfam:AMP-binding 7 449 2.1e-58 PFAM
Pfam:PP-binding 556 628 1e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201283
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154548
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.3%
Validation Efficiency
MGI Phenotype FUNCTION: The gene product is a cytosolic enzyme involved in the production of alpha-aminoadipic acid from alpha-aminoadipic semialdehyde. It is postulated that this enzyme plays a role in lysine metabolism. There is currently debate regarding this enzyme's putative requirement of pyrroloquinoline quinine as an essential cofactor. A related pseudogene has been identified on chromosome 2. [provided by RefSeq, Jan 2010]
Allele List at MGI

All alleles(14) : Gene trapped(14)

Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts2 C T 11: 50,683,612 (GRCm39) P965S probably damaging Het
Ankrd11 A G 8: 123,618,485 (GRCm39) I1768T probably benign Het
Arsi G A 18: 61,049,723 (GRCm39) G202E probably benign Het
Baz2b A T 2: 59,743,234 (GRCm39) L1579Q probably damaging Het
Btbd7 A G 12: 102,757,034 (GRCm39) V684A probably damaging Het
Camk1g T A 1: 193,038,665 (GRCm39) I86F probably benign Het
Capn13 A T 17: 73,689,889 (GRCm39) S41T possibly damaging Het
Cep192 C A 18: 67,980,504 (GRCm39) L1422I probably damaging Het
Chaf1a T C 17: 56,354,380 (GRCm39) F217L unknown Het
Clca3b A T 3: 144,529,274 (GRCm39) M800K possibly damaging Het
Cplane1 A G 15: 8,258,443 (GRCm39) T2230A probably benign Het
Crocc A G 4: 140,744,388 (GRCm39) V1836A probably benign Het
Csmd2 G A 4: 128,377,188 (GRCm39) V2023M possibly damaging Het
Cul9 A G 17: 46,854,486 (GRCm39) V72A possibly damaging Het
Ddx52 T C 11: 83,834,269 (GRCm39) probably null Het
Dennd5b A C 6: 148,969,703 (GRCm39) V250G probably damaging Het
Fabp3 C T 4: 130,206,180 (GRCm39) T57I probably benign Het
Gtpbp4 A T 13: 9,023,285 (GRCm39) M593K probably benign Het
Il21 A G 3: 37,286,681 (GRCm39) F12L probably benign Het
Lrit2 T A 14: 36,791,105 (GRCm39) N261K probably benign Het
Lrrc39 G T 3: 116,364,562 (GRCm39) C151F probably damaging Het
Lsm14a C A 7: 34,050,799 (GRCm39) R426L probably damaging Het
Maml1 G A 11: 50,157,774 (GRCm39) P134S probably benign Het
Map3k13 T C 16: 21,722,542 (GRCm39) C235R probably damaging Het
Naip2 C T 13: 100,298,489 (GRCm39) A516T possibly damaging Het
Nsmaf T C 4: 6,409,884 (GRCm39) E663G probably benign Het
Ntrk3 T C 7: 78,005,822 (GRCm39) N513S probably damaging Het
Nufip1 T G 14: 76,363,692 (GRCm39) N305K possibly damaging Het
Or10al5 C T 17: 38,062,916 (GRCm39) T57I possibly damaging Het
Or2ag1b T A 7: 106,288,918 (GRCm39) T7S probably benign Het
Or4c10b A T 2: 89,711,745 (GRCm39) T192S probably benign Het
Or51a6 T A 7: 102,604,175 (GRCm39) D218V probably benign Het
Or9r3 A T 10: 129,947,872 (GRCm39) Y262* probably null Het
Pi4ka A G 16: 17,194,894 (GRCm39) V168A probably benign Het
Prex2 T C 1: 11,301,996 (GRCm39) V1433A probably damaging Het
Prl7a1 A T 13: 27,817,612 (GRCm39) D217E probably damaging Het
Prr3 G A 17: 36,285,484 (GRCm39) R86* probably null Het
Ptprz1 T C 6: 23,049,605 (GRCm39) F1350L probably damaging Het
R3hcc1l T C 19: 42,552,046 (GRCm39) S348P possibly damaging Het
Rag2 A T 2: 101,459,960 (GRCm39) Q90L probably benign Het
Scel T C 14: 103,770,752 (GRCm39) L62P probably damaging Het
Serpini1 A T 3: 75,521,977 (GRCm39) E156V possibly damaging Het
Skint4 T A 4: 111,993,240 (GRCm39) I321K possibly damaging Het
Slc28a2 A G 2: 122,286,098 (GRCm39) D478G probably damaging Het
Sppl2b G T 10: 80,700,965 (GRCm39) V164F probably damaging Het
Traf5 T A 1: 191,729,470 (GRCm39) N527I probably benign Het
Ttc3 T A 16: 94,244,176 (GRCm39) D17E probably benign Het
Txlnb G A 10: 17,682,521 (GRCm39) A148T possibly damaging Het
Ubtf A G 11: 102,201,757 (GRCm39) Y256H probably damaging Het
Usp25 T C 16: 76,868,559 (GRCm39) F320S possibly damaging Het
Utp14b T C 1: 78,643,656 (GRCm39) V518A probably benign Het
Utp20 A G 10: 88,593,834 (GRCm39) V2192A possibly damaging Het
Vmn1r173 T A 7: 23,402,533 (GRCm39) M256K probably benign Het
Vmn2r114 T A 17: 23,515,962 (GRCm39) M510L probably benign Het
Xdh T A 17: 74,233,547 (GRCm39) Q189L probably benign Het
Zfat C T 15: 68,051,959 (GRCm39) A605T probably benign Het
Other mutations in Aasdh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00823:Aasdh APN 5 77,026,381 (GRCm39) unclassified probably benign
IGL01013:Aasdh APN 5 77,034,053 (GRCm39) missense possibly damaging 0.68
IGL01558:Aasdh APN 5 77,036,464 (GRCm39) missense possibly damaging 0.89
IGL02544:Aasdh APN 5 77,049,961 (GRCm39) missense probably benign 0.27
IGL02614:Aasdh APN 5 77,044,215 (GRCm39) splice site probably benign
IGL02678:Aasdh APN 5 77,035,867 (GRCm39) splice site probably benign
IGL02739:Aasdh APN 5 77,026,364 (GRCm39) missense possibly damaging 0.64
IGL02947:Aasdh APN 5 77,049,957 (GRCm39) missense probably benign 0.01
IGL03116:Aasdh APN 5 77,049,936 (GRCm39) splice site probably null
IGL03398:Aasdh APN 5 77,039,566 (GRCm39) missense probably benign 0.02
1mM(1):Aasdh UTSW 5 77,044,464 (GRCm39) missense possibly damaging 0.91
R0183:Aasdh UTSW 5 77,034,082 (GRCm39) missense probably benign 0.05
R0226:Aasdh UTSW 5 77,049,849 (GRCm39) missense probably damaging 1.00
R0367:Aasdh UTSW 5 77,049,961 (GRCm39) missense probably damaging 0.99
R0386:Aasdh UTSW 5 77,044,308 (GRCm39) missense probably damaging 0.98
R0529:Aasdh UTSW 5 77,024,114 (GRCm39) nonsense probably null
R0881:Aasdh UTSW 5 77,024,130 (GRCm39) missense probably damaging 1.00
R0882:Aasdh UTSW 5 77,024,130 (GRCm39) missense probably damaging 1.00
R1033:Aasdh UTSW 5 77,024,130 (GRCm39) missense probably damaging 1.00
R1034:Aasdh UTSW 5 77,024,130 (GRCm39) missense probably damaging 1.00
R1035:Aasdh UTSW 5 77,024,130 (GRCm39) missense probably damaging 1.00
R1036:Aasdh UTSW 5 77,024,130 (GRCm39) missense probably damaging 1.00
R1366:Aasdh UTSW 5 77,036,651 (GRCm39) missense probably benign 0.10
R1446:Aasdh UTSW 5 77,034,136 (GRCm39) missense probably benign 0.45
R1449:Aasdh UTSW 5 77,034,136 (GRCm39) missense probably benign 0.45
R1469:Aasdh UTSW 5 77,039,526 (GRCm39) missense probably damaging 0.97
R1469:Aasdh UTSW 5 77,039,526 (GRCm39) missense probably damaging 0.97
R1583:Aasdh UTSW 5 77,030,528 (GRCm39) missense probably benign 0.00
R1876:Aasdh UTSW 5 77,025,396 (GRCm39) missense probably damaging 1.00
R1895:Aasdh UTSW 5 77,039,551 (GRCm39) missense probably damaging 1.00
R1946:Aasdh UTSW 5 77,039,551 (GRCm39) missense probably damaging 1.00
R3615:Aasdh UTSW 5 77,036,629 (GRCm39) missense probably benign 0.20
R3616:Aasdh UTSW 5 77,036,629 (GRCm39) missense probably benign 0.20
R3746:Aasdh UTSW 5 77,036,501 (GRCm39) nonsense probably null
R3747:Aasdh UTSW 5 77,036,501 (GRCm39) nonsense probably null
R3748:Aasdh UTSW 5 77,036,501 (GRCm39) nonsense probably null
R3750:Aasdh UTSW 5 77,036,501 (GRCm39) nonsense probably null
R3836:Aasdh UTSW 5 77,026,315 (GRCm39) missense probably benign 0.32
R4857:Aasdh UTSW 5 77,035,131 (GRCm39) missense probably benign 0.01
R4928:Aasdh UTSW 5 77,044,535 (GRCm39) missense possibly damaging 0.65
R4937:Aasdh UTSW 5 77,036,501 (GRCm39) nonsense probably null
R5762:Aasdh UTSW 5 77,044,445 (GRCm39) missense probably benign 0.00
R5866:Aasdh UTSW 5 77,024,058 (GRCm39) missense probably damaging 1.00
R5940:Aasdh UTSW 5 77,030,745 (GRCm39) missense probably benign 0.07
R6253:Aasdh UTSW 5 77,034,105 (GRCm39) missense possibly damaging 0.81
R6542:Aasdh UTSW 5 77,030,902 (GRCm39) missense probably damaging 1.00
R6825:Aasdh UTSW 5 77,036,696 (GRCm39) splice site probably null
R6868:Aasdh UTSW 5 77,039,527 (GRCm39) missense probably damaging 0.99
R6876:Aasdh UTSW 5 77,044,288 (GRCm39) missense probably damaging 1.00
R6961:Aasdh UTSW 5 77,024,148 (GRCm39) missense probably damaging 1.00
R6963:Aasdh UTSW 5 77,044,303 (GRCm39) missense probably damaging 0.99
R7069:Aasdh UTSW 5 77,024,203 (GRCm39) missense probably benign 0.03
R7220:Aasdh UTSW 5 77,049,772 (GRCm39) missense probably benign 0.13
R7545:Aasdh UTSW 5 77,027,861 (GRCm39) missense probably damaging 1.00
R7673:Aasdh UTSW 5 77,030,555 (GRCm39) missense probably benign 0.03
R7703:Aasdh UTSW 5 77,035,924 (GRCm39) missense probably damaging 0.99
R7890:Aasdh UTSW 5 77,031,969 (GRCm39) missense probably benign 0.19
R7978:Aasdh UTSW 5 77,036,515 (GRCm39) missense probably damaging 0.99
R8046:Aasdh UTSW 5 77,044,325 (GRCm39) missense probably benign
R8152:Aasdh UTSW 5 77,044,305 (GRCm39) missense probably damaging 1.00
R8425:Aasdh UTSW 5 77,034,124 (GRCm39) missense possibly damaging 0.49
R8884:Aasdh UTSW 5 77,039,641 (GRCm39) missense possibly damaging 0.94
R9028:Aasdh UTSW 5 77,023,977 (GRCm39) missense probably damaging 1.00
R9361:Aasdh UTSW 5 77,030,225 (GRCm39) missense probably benign 0.01
R9519:Aasdh UTSW 5 77,030,572 (GRCm39) missense probably benign 0.00
Z1088:Aasdh UTSW 5 77,049,004 (GRCm39) splice site probably null
Z1176:Aasdh UTSW 5 77,039,643 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- ACAGTCACTCTGTGGCGGGAAAAG -3'
(R):5'- AAGGGGTTTCCACTAGCAACAGCG -3'

Sequencing Primer
(F):5'- AGAGAATGTCAGCTAATTTTGATGG -3'
(R):5'- ccttttcctcttcctcttcctc -3'
Posted On 2014-04-24