Incidental Mutation 'R1641:Ubtf'
ID 173550
Institutional Source Beutler Lab
Gene Symbol Ubtf
Ensembl Gene ENSMUSG00000020923
Gene Name upstream binding transcription factor, RNA polymerase I
Synonyms UBF1, UBF, A930005G04Rik, Tcfubf
MMRRC Submission 039677-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1641 (G1)
Quality Score 165
Status Not validated
Chromosome 11
Chromosomal Location 102195386-102210568 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 102201757 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 256 (Y256H)
Ref Sequence ENSEMBL: ENSMUSP00000133844 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006754] [ENSMUST00000079589] [ENSMUST00000107115] [ENSMUST00000107117] [ENSMUST00000107119] [ENSMUST00000107123] [ENSMUST00000173870] [ENSMUST00000174302] [ENSMUST00000178839] [ENSMUST00000128016] [ENSMUST00000146896]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000006754
SMART Domains Protein: ENSMUSP00000006754
Gene: ENSMUSG00000020923

DomainStartEndE-ValueType
Blast:SANT 18 78 6e-32 BLAST
HMG 111 181 5.56e-20 SMART
HMG 260 326 1.1e-14 SMART
HMG 369 439 6.29e-19 SMART
HMG 444 513 4.74e-5 SMART
HMG 530 598 2.54e-14 SMART
low complexity region 640 661 N/A INTRINSIC
low complexity region 677 705 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000079589
AA Change: Y256H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000078539
Gene: ENSMUSG00000020923
AA Change: Y256H

DomainStartEndE-ValueType
Blast:SANT 18 78 8e-32 BLAST
HMG 111 181 5.56e-20 SMART
HMG 195 265 1.95e-15 SMART
HMG 297 363 1.1e-14 SMART
HMG 406 476 6.29e-19 SMART
HMG 481 550 4.74e-5 SMART
HMG 567 635 2.54e-14 SMART
low complexity region 675 763 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107115
SMART Domains Protein: ENSMUSP00000102732
Gene: ENSMUSG00000020923

DomainStartEndE-ValueType
Blast:SANT 18 78 8e-32 BLAST
HMG 111 181 5.56e-20 SMART
HMG 260 326 1.1e-14 SMART
HMG 369 439 6.29e-19 SMART
HMG 444 513 4.74e-5 SMART
HMG 530 598 2.54e-14 SMART
low complexity region 638 726 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107117
SMART Domains Protein: ENSMUSP00000102734
Gene: ENSMUSG00000020923

DomainStartEndE-ValueType
Blast:SANT 18 78 8e-32 BLAST
HMG 111 181 5.56e-20 SMART
HMG 260 326 1.1e-14 SMART
HMG 369 439 6.29e-19 SMART
HMG 444 513 4.74e-5 SMART
HMG 530 598 2.54e-14 SMART
low complexity region 638 726 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107119
SMART Domains Protein: ENSMUSP00000102736
Gene: ENSMUSG00000020923

DomainStartEndE-ValueType
Blast:SANT 18 78 8e-32 BLAST
HMG 111 181 5.56e-20 SMART
HMG 260 326 1.1e-14 SMART
HMG 369 439 6.29e-19 SMART
HMG 444 513 4.74e-5 SMART
HMG 530 598 2.54e-14 SMART
low complexity region 638 726 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107123
AA Change: Y256H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102740
Gene: ENSMUSG00000020923
AA Change: Y256H

DomainStartEndE-ValueType
Blast:SANT 18 78 8e-32 BLAST
HMG 111 181 5.56e-20 SMART
HMG 195 265 1.95e-15 SMART
HMG 297 363 1.1e-14 SMART
HMG 406 476 6.29e-19 SMART
HMG 481 550 4.74e-5 SMART
HMG 567 635 2.54e-14 SMART
low complexity region 675 763 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000173870
AA Change: Y256H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000133611
Gene: ENSMUSG00000020923
AA Change: Y256H

DomainStartEndE-ValueType
Blast:SANT 18 78 8e-32 BLAST
HMG 111 181 5.56e-20 SMART
HMG 195 265 1.95e-15 SMART
HMG 297 363 1.1e-14 SMART
HMG 406 476 6.29e-19 SMART
HMG 481 550 4.74e-5 SMART
HMG 567 635 2.54e-14 SMART
low complexity region 675 763 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000174302
AA Change: Y256H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000133844
Gene: ENSMUSG00000020923
AA Change: Y256H

DomainStartEndE-ValueType
Blast:SANT 18 78 8e-32 BLAST
HMG 111 181 5.56e-20 SMART
HMG 195 265 1.95e-15 SMART
HMG 297 363 1.1e-14 SMART
HMG 406 476 6.29e-19 SMART
HMG 481 550 4.74e-5 SMART
HMG 567 635 2.54e-14 SMART
low complexity region 675 763 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174400
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174726
Predicted Effect probably benign
Transcript: ENSMUST00000178839
SMART Domains Protein: ENSMUSP00000136310
Gene: ENSMUSG00000020923

DomainStartEndE-ValueType
Blast:SANT 18 78 8e-32 BLAST
HMG 111 181 5.56e-20 SMART
HMG 260 326 1.1e-14 SMART
HMG 369 439 6.29e-19 SMART
HMG 444 513 4.74e-5 SMART
HMG 530 598 2.54e-14 SMART
low complexity region 638 726 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128016
SMART Domains Protein: ENSMUSP00000131930
Gene: ENSMUSG00000020923

DomainStartEndE-ValueType
Blast:SANT 18 78 2e-34 BLAST
HMG 111 169 1.15e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146896
SMART Domains Protein: ENSMUSP00000134665
Gene: ENSMUSG00000020923

DomainStartEndE-ValueType
Blast:SANT 18 78 1e-34 BLAST
HMG 83 151 2.09e-15 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the HMG-box DNA-binding protein family. The encoded protein plays a critical role in ribosomal RNA transcription as a key component of the pre-initiation complex, mediating the recruitment of RNA polymerase I to rDNA promoter regions. The encoded protein may also play important roles in chromatin remodeling and pre-rRNA processing, and its activity is regulated by both phosphorylation and acetylation. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. Pseudogenes of this gene are located on the short arm of chromosomes 3, 11 and X and the long arm of chromosome 11. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality before implantation with embryonic growth arrest. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh T A 5: 77,039,626 (GRCm39) T228S probably benign Het
Adamts2 C T 11: 50,683,612 (GRCm39) P965S probably damaging Het
Ankrd11 A G 8: 123,618,485 (GRCm39) I1768T probably benign Het
Arsi G A 18: 61,049,723 (GRCm39) G202E probably benign Het
Baz2b A T 2: 59,743,234 (GRCm39) L1579Q probably damaging Het
Btbd7 A G 12: 102,757,034 (GRCm39) V684A probably damaging Het
Camk1g T A 1: 193,038,665 (GRCm39) I86F probably benign Het
Capn13 A T 17: 73,689,889 (GRCm39) S41T possibly damaging Het
Cep192 C A 18: 67,980,504 (GRCm39) L1422I probably damaging Het
Chaf1a T C 17: 56,354,380 (GRCm39) F217L unknown Het
Clca3b A T 3: 144,529,274 (GRCm39) M800K possibly damaging Het
Cplane1 A G 15: 8,258,443 (GRCm39) T2230A probably benign Het
Crocc A G 4: 140,744,388 (GRCm39) V1836A probably benign Het
Csmd2 G A 4: 128,377,188 (GRCm39) V2023M possibly damaging Het
Cul9 A G 17: 46,854,486 (GRCm39) V72A possibly damaging Het
Ddx52 T C 11: 83,834,269 (GRCm39) probably null Het
Dennd5b A C 6: 148,969,703 (GRCm39) V250G probably damaging Het
Fabp3 C T 4: 130,206,180 (GRCm39) T57I probably benign Het
Gtpbp4 A T 13: 9,023,285 (GRCm39) M593K probably benign Het
Il21 A G 3: 37,286,681 (GRCm39) F12L probably benign Het
Lrit2 T A 14: 36,791,105 (GRCm39) N261K probably benign Het
Lrrc39 G T 3: 116,364,562 (GRCm39) C151F probably damaging Het
Lsm14a C A 7: 34,050,799 (GRCm39) R426L probably damaging Het
Maml1 G A 11: 50,157,774 (GRCm39) P134S probably benign Het
Map3k13 T C 16: 21,722,542 (GRCm39) C235R probably damaging Het
Naip2 C T 13: 100,298,489 (GRCm39) A516T possibly damaging Het
Nsmaf T C 4: 6,409,884 (GRCm39) E663G probably benign Het
Ntrk3 T C 7: 78,005,822 (GRCm39) N513S probably damaging Het
Nufip1 T G 14: 76,363,692 (GRCm39) N305K possibly damaging Het
Or10al5 C T 17: 38,062,916 (GRCm39) T57I possibly damaging Het
Or2ag1b T A 7: 106,288,918 (GRCm39) T7S probably benign Het
Or4c10b A T 2: 89,711,745 (GRCm39) T192S probably benign Het
Or51a6 T A 7: 102,604,175 (GRCm39) D218V probably benign Het
Or9r3 A T 10: 129,947,872 (GRCm39) Y262* probably null Het
Pi4ka A G 16: 17,194,894 (GRCm39) V168A probably benign Het
Prex2 T C 1: 11,301,996 (GRCm39) V1433A probably damaging Het
Prl7a1 A T 13: 27,817,612 (GRCm39) D217E probably damaging Het
Prr3 G A 17: 36,285,484 (GRCm39) R86* probably null Het
Ptprz1 T C 6: 23,049,605 (GRCm39) F1350L probably damaging Het
R3hcc1l T C 19: 42,552,046 (GRCm39) S348P possibly damaging Het
Rag2 A T 2: 101,459,960 (GRCm39) Q90L probably benign Het
Scel T C 14: 103,770,752 (GRCm39) L62P probably damaging Het
Serpini1 A T 3: 75,521,977 (GRCm39) E156V possibly damaging Het
Skint4 T A 4: 111,993,240 (GRCm39) I321K possibly damaging Het
Slc28a2 A G 2: 122,286,098 (GRCm39) D478G probably damaging Het
Sppl2b G T 10: 80,700,965 (GRCm39) V164F probably damaging Het
Traf5 T A 1: 191,729,470 (GRCm39) N527I probably benign Het
Ttc3 T A 16: 94,244,176 (GRCm39) D17E probably benign Het
Txlnb G A 10: 17,682,521 (GRCm39) A148T possibly damaging Het
Usp25 T C 16: 76,868,559 (GRCm39) F320S possibly damaging Het
Utp14b T C 1: 78,643,656 (GRCm39) V518A probably benign Het
Utp20 A G 10: 88,593,834 (GRCm39) V2192A possibly damaging Het
Vmn1r173 T A 7: 23,402,533 (GRCm39) M256K probably benign Het
Vmn2r114 T A 17: 23,515,962 (GRCm39) M510L probably benign Het
Xdh T A 17: 74,233,547 (GRCm39) Q189L probably benign Het
Zfat C T 15: 68,051,959 (GRCm39) A605T probably benign Het
Other mutations in Ubtf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01066:Ubtf APN 11 102,199,710 (GRCm39) splice site probably benign
IGL02168:Ubtf APN 11 102,204,994 (GRCm39) missense probably damaging 0.99
IGL02218:Ubtf APN 11 102,197,526 (GRCm39) nonsense probably null
FR4304:Ubtf UTSW 11 102,197,784 (GRCm39) small insertion probably benign
FR4304:Ubtf UTSW 11 102,197,782 (GRCm39) small insertion probably benign
FR4340:Ubtf UTSW 11 102,197,776 (GRCm39) small insertion probably benign
FR4342:Ubtf UTSW 11 102,197,785 (GRCm39) small insertion probably benign
FR4342:Ubtf UTSW 11 102,197,782 (GRCm39) small insertion probably benign
FR4449:Ubtf UTSW 11 102,197,774 (GRCm39) nonsense probably null
FR4548:Ubtf UTSW 11 102,197,784 (GRCm39) small insertion probably benign
FR4589:Ubtf UTSW 11 102,197,771 (GRCm39) small insertion probably benign
FR4589:Ubtf UTSW 11 102,197,769 (GRCm39) small insertion probably benign
FR4737:Ubtf UTSW 11 102,197,776 (GRCm39) small insertion probably benign
FR4737:Ubtf UTSW 11 102,197,774 (GRCm39) nonsense probably null
FR4976:Ubtf UTSW 11 102,197,785 (GRCm39) small insertion probably benign
PIT4504001:Ubtf UTSW 11 102,197,508 (GRCm39) missense unknown
R0919:Ubtf UTSW 11 102,200,603 (GRCm39) splice site probably benign
R1023:Ubtf UTSW 11 102,202,276 (GRCm39) missense possibly damaging 0.93
R1678:Ubtf UTSW 11 102,199,804 (GRCm39) missense probably benign 0.01
R1780:Ubtf UTSW 11 102,205,744 (GRCm39) missense probably damaging 1.00
R2406:Ubtf UTSW 11 102,199,528 (GRCm39) nonsense probably null
R4574:Ubtf UTSW 11 102,197,591 (GRCm39) unclassified probably benign
R4986:Ubtf UTSW 11 102,205,000 (GRCm39) missense probably benign 0.03
R5057:Ubtf UTSW 11 102,197,913 (GRCm39) missense probably damaging 0.96
R5217:Ubtf UTSW 11 102,199,128 (GRCm39) missense probably null 0.91
R5221:Ubtf UTSW 11 102,198,816 (GRCm39) nonsense probably null
R5532:Ubtf UTSW 11 102,199,785 (GRCm39) missense probably benign 0.00
R5634:Ubtf UTSW 11 102,201,150 (GRCm39) missense probably damaging 1.00
R6185:Ubtf UTSW 11 102,204,849 (GRCm39) missense probably damaging 1.00
R7028:Ubtf UTSW 11 102,205,806 (GRCm39) missense probably benign 0.03
R7450:Ubtf UTSW 11 102,197,475 (GRCm39) missense unknown
R7596:Ubtf UTSW 11 102,197,533 (GRCm39) missense unknown
R7601:Ubtf UTSW 11 102,197,480 (GRCm39) missense unknown
R8376:Ubtf UTSW 11 102,199,737 (GRCm39) missense probably damaging 1.00
R8934:Ubtf UTSW 11 102,204,855 (GRCm39) missense probably damaging 0.98
R8947:Ubtf UTSW 11 102,205,802 (GRCm39) missense possibly damaging 0.67
R9102:Ubtf UTSW 11 102,201,015 (GRCm39) critical splice donor site probably null
R9395:Ubtf UTSW 11 102,205,026 (GRCm39) missense probably damaging 1.00
R9701:Ubtf UTSW 11 102,199,718 (GRCm39) critical splice donor site probably null
RF027:Ubtf UTSW 11 102,197,771 (GRCm39) small insertion probably benign
RF036:Ubtf UTSW 11 102,197,771 (GRCm39) small insertion probably benign
RF041:Ubtf UTSW 11 102,197,771 (GRCm39) small insertion probably benign
Predicted Primers PCR Primer
(F):5'- TGCAATATGGTGTCCTGCTCTGC -3'
(R):5'- CAACTGTGGTACACCCACGAGAAG -3'

Sequencing Primer
(F):5'- AGATCTCTCGGGTGGGAAC -3'
(R):5'- GTGTATCTCAAAGTGCGGC -3'
Posted On 2014-04-24