Incidental Mutation 'R1641:Lrit2'
ID173557
Institutional Source Beutler Lab
Gene Symbol Lrit2
Ensembl Gene ENSMUSG00000043418
Gene Nameleucine-rich repeat, immunoglobulin-like and transmembrane domains 2
SynonymsA930010E21Rik, Lrrc22
MMRRC Submission 039677-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R1641 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location37067929-37073743 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 37069148 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 261 (N261K)
Ref Sequence ENSEMBL: ENSMUSP00000056642 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057176] [ENSMUST00000120052]
Predicted Effect probably benign
Transcript: ENSMUST00000057176
AA Change: N261K

PolyPhen 2 Score 0.345 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000056642
Gene: ENSMUSG00000043418
AA Change: N261K

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LRRNT 23 59 7.74e-2 SMART
LRR 78 101 9.96e-1 SMART
LRR_TYP 102 125 8.94e-3 SMART
LRR 126 149 2.03e1 SMART
LRR_TYP 150 173 7.67e-2 SMART
LRRCT 200 251 7.12e-7 SMART
IGc2 265 334 2.05e-9 SMART
FN3 362 443 5.94e0 SMART
transmembrane domain 463 485 N/A INTRINSIC
low complexity region 538 546 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120052
SMART Domains Protein: ENSMUSP00000113964
Gene: ENSMUSG00000041044

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
LRRNT 22 63 1.97e-3 SMART
LRR 82 105 1.03e1 SMART
LRR 106 129 3e1 SMART
LRR 130 152 1.12e1 SMART
LRR_TYP 154 177 4.47e-3 SMART
LRRCT 201 253 2.04e-7 SMART
IGc2 267 336 6.55e-8 SMART
FN3 429 506 2.22e0 SMART
transmembrane domain 531 553 N/A INTRINSIC
low complexity region 581 595 N/A INTRINSIC
low complexity region 597 608 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224104
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,228,959 T2230A probably benign Het
Aasdh T A 5: 76,891,779 T228S probably benign Het
Adamts2 C T 11: 50,792,785 P965S probably damaging Het
Ankrd11 A G 8: 122,891,746 I1768T probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Baz2b A T 2: 59,912,890 L1579Q probably damaging Het
Btbd7 A G 12: 102,790,775 V684A probably damaging Het
Camk1g T A 1: 193,356,357 I86F probably benign Het
Capn13 A T 17: 73,382,894 S41T possibly damaging Het
Cep192 C A 18: 67,847,433 L1422I probably damaging Het
Chaf1a T C 17: 56,047,380 F217L unknown Het
Clca3b A T 3: 144,823,513 M800K possibly damaging Het
Crocc A G 4: 141,017,077 V1836A probably benign Het
Csmd2 G A 4: 128,483,395 V2023M possibly damaging Het
Cul9 A G 17: 46,543,560 V72A possibly damaging Het
Ddx52 T C 11: 83,943,443 probably null Het
Dennd5b A C 6: 149,068,205 V250G probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Gtpbp4 A T 13: 8,973,249 M593K probably benign Het
Il21 A G 3: 37,232,532 F12L probably benign Het
Lrrc39 G T 3: 116,570,913 C151F probably damaging Het
Lsm14a C A 7: 34,351,374 R426L probably damaging Het
Maml1 G A 11: 50,266,947 P134S probably benign Het
Map3k13 T C 16: 21,903,792 C235R probably damaging Het
Naip2 C T 13: 100,161,981 A516T possibly damaging Het
Nsmaf T C 4: 6,409,884 E663G probably benign Het
Ntrk3 T C 7: 78,356,074 N513S probably damaging Het
Nufip1 T G 14: 76,126,252 N305K possibly damaging Het
Olfr121 C T 17: 37,752,025 T57I possibly damaging Het
Olfr1257 A T 2: 89,881,401 T192S probably benign Het
Olfr575 T A 7: 102,954,968 D218V probably benign Het
Olfr694 T A 7: 106,689,711 T7S probably benign Het
Olfr823 A T 10: 130,112,003 Y262* probably null Het
Pi4ka A G 16: 17,377,030 V168A probably benign Het
Prex2 T C 1: 11,231,772 V1433A probably damaging Het
Prl7a1 A T 13: 27,633,629 D217E probably damaging Het
Prr3 G A 17: 35,974,592 R86* probably null Het
Ptprz1 T C 6: 23,049,606 F1350L probably damaging Het
R3hcc1l T C 19: 42,563,607 S348P possibly damaging Het
Rag2 A T 2: 101,629,615 Q90L probably benign Het
Scel T C 14: 103,533,316 L62P probably damaging Het
Serpini1 A T 3: 75,614,670 E156V possibly damaging Het
Skint4 T A 4: 112,136,043 I321K possibly damaging Het
Slc28a2 A G 2: 122,455,617 D478G probably damaging Het
Sppl2b G T 10: 80,865,131 V164F probably damaging Het
Traf5 T A 1: 191,997,509 N527I probably benign Het
Ttc3 T A 16: 94,443,317 D17E probably benign Het
Txlnb G A 10: 17,806,773 A148T possibly damaging Het
Ubtf A G 11: 102,310,931 Y256H probably damaging Het
Usp25 T C 16: 77,071,671 F320S possibly damaging Het
Utp14b T C 1: 78,665,939 V518A probably benign Het
Utp20 A G 10: 88,757,972 V2192A possibly damaging Het
Vmn1r173 T A 7: 23,703,108 M256K probably benign Het
Vmn2r114 T A 17: 23,296,988 M510L probably benign Het
Xdh T A 17: 73,926,552 Q189L probably benign Het
Zfat C T 15: 68,180,110 A605T probably benign Het
Other mutations in Lrit2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Lrit2 APN 14 37071963 missense probably benign 0.31
IGL01475:Lrit2 APN 14 37069094 missense probably damaging 1.00
IGL02080:Lrit2 APN 14 37069074 missense probably damaging 0.99
IGL02141:Lrit2 APN 14 37068074 unclassified probably benign
IGL02479:Lrit2 APN 14 37072278 missense probably damaging 0.99
IGL02715:Lrit2 APN 14 37072548 missense probably benign 0.00
R0114:Lrit2 UTSW 14 37068045 unclassified probably null
R1344:Lrit2 UTSW 14 37068556 missense probably benign 0.32
R1529:Lrit2 UTSW 14 37068827 missense probably benign 0.12
R2105:Lrit2 UTSW 14 37071956 missense probably damaging 1.00
R4365:Lrit2 UTSW 14 37072119 missense probably damaging 1.00
R4645:Lrit2 UTSW 14 37072475 missense probably benign
R5226:Lrit2 UTSW 14 37072353 missense probably damaging 1.00
R5377:Lrit2 UTSW 14 37069183 missense possibly damaging 0.59
R5387:Lrit2 UTSW 14 37072259 missense probably damaging 1.00
R5840:Lrit2 UTSW 14 37069005 missense possibly damaging 0.64
R5881:Lrit2 UTSW 14 37072235 missense probably benign 0.02
R6499:Lrit2 UTSW 14 37068810 missense probably damaging 0.98
R6863:Lrit2 UTSW 14 37071944 missense probably damaging 0.99
R7307:Lrit2 UTSW 14 37072199 missense probably benign 0.00
R7316:Lrit2 UTSW 14 37068858 missense probably damaging 1.00
R7491:Lrit2 UTSW 14 37068910 missense possibly damaging 0.83
R7525:Lrit2 UTSW 14 37072493 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- GATTCTGTCCCAGAACTGGCTCTTC -3'
(R):5'- GCACCCATCCTTTATGACAGGCAC -3'

Sequencing Primer
(F):5'- GGTATTGTCGCTGCACAATAATCC -3'
(R):5'- ACCTCTATATTGAGGCAGAGTCC -3'
Posted On2014-04-24