Mutagenetix > Incidental Mutation

Incidental Mutation 'R1641:Scel'

173559

Institutional Source

Beutler Lab

Gene Symbol

Scel

Ensembl Gene

ENSMUSG00000022123

Gene Name

sciellin

Synonyms

9230114I02Rik

MMRRC Submission

039677-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1641 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

103513342-103612797 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 103533316 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 62 (L62P)

Ref Sequence

ENSEMBL: ENSMUSP00000154402 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095576] [ENSMUST00000227322]

AlphaFold

Q9EQG3

Predicted Effect

probably damaging
Transcript: ENSMUST00000095576
AA Change: L62P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000093233
Gene: ENSMUSG00000022123
AA Change: L62P

Domain	Start	End	E-Value	Type
low complexity region	111	131	N/A	INTRINSIC
low complexity region	159	178	N/A	INTRINSIC
internal_repeat_1	204	327	9.24e-7	PROSPERO
internal_repeat_1	378	505	9.24e-7	PROSPERO
low complexity region	525	537	N/A	INTRINSIC
LIM	584	642	2.23e-3	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000227322
AA Change: L62P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Coding Region Coverage

1x: 99.0%
3x: 98.0%
10x: 95.3%
20x: 89.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a precursor to the cornified envelope of terminally differentiated keratinocytes. This protein localizes to the periphery of cells and may function in the assembly or regulation of proteins in the cornified envelope. Transcript variants encoding different isoforms exist. A transcript variant utilizing an alternative polyA signal has been described in the literature, but its full-length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are viable and fertile with normal hair morphology and development and normal skin morphology and barrier function. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	A	G	15: 8,228,959	T2230A	probably benign	Het
Aasdh	T	A	5: 76,891,779	T228S	probably benign	Het
Adamts2	C	T	11: 50,792,785	P965S	probably damaging	Het
Ankrd11	A	G	8: 122,891,746	I1768T	probably benign	Het
Arsi	G	A	18: 60,916,651	G202E	probably benign	Het
Baz2b	A	T	2: 59,912,890	L1579Q	probably damaging	Het
Btbd7	A	G	12: 102,790,775	V684A	probably damaging	Het
Camk1g	T	A	1: 193,356,357	I86F	probably benign	Het
Capn13	A	T	17: 73,382,894	S41T	possibly damaging	Het
Cep192	C	A	18: 67,847,433	L1422I	probably damaging	Het
Chaf1a	T	C	17: 56,047,380	F217L	unknown	Het
Clca3b	A	T	3: 144,823,513	M800K	possibly damaging	Het
Crocc	A	G	4: 141,017,077	V1836A	probably benign	Het
Csmd2	G	A	4: 128,483,395	V2023M	possibly damaging	Het
Cul9	A	G	17: 46,543,560	V72A	possibly damaging	Het
Ddx52	T	C	11: 83,943,443		probably null	Het
Dennd5b	A	C	6: 149,068,205	V250G	probably damaging	Het
Fabp3	C	T	4: 130,312,387	T57I	probably benign	Het
Gtpbp4	A	T	13: 8,973,249	M593K	probably benign	Het
Il21	A	G	3: 37,232,532	F12L	probably benign	Het
Lrit2	T	A	14: 37,069,148	N261K	probably benign	Het
Lrrc39	G	T	3: 116,570,913	C151F	probably damaging	Het
Lsm14a	C	A	7: 34,351,374	R426L	probably damaging	Het
Maml1	G	A	11: 50,266,947	P134S	probably benign	Het
Map3k13	T	C	16: 21,903,792	C235R	probably damaging	Het
Naip2	C	T	13: 100,161,981	A516T	possibly damaging	Het
Nsmaf	T	C	4: 6,409,884	E663G	probably benign	Het
Ntrk3	T	C	7: 78,356,074	N513S	probably damaging	Het
Nufip1	T	G	14: 76,126,252	N305K	possibly damaging	Het
Olfr121	C	T	17: 37,752,025	T57I	possibly damaging	Het
Olfr1257	A	T	2: 89,881,401	T192S	probably benign	Het
Olfr575	T	A	7: 102,954,968	D218V	probably benign	Het
Olfr694	T	A	7: 106,689,711	T7S	probably benign	Het
Olfr823	A	T	10: 130,112,003	Y262*	probably null	Het
Pi4ka	A	G	16: 17,377,030	V168A	probably benign	Het
Prex2	T	C	1: 11,231,772	V1433A	probably damaging	Het
Prl7a1	A	T	13: 27,633,629	D217E	probably damaging	Het
Prr3	G	A	17: 35,974,592	R86*	probably null	Het
Ptprz1	T	C	6: 23,049,606	F1350L	probably damaging	Het
R3hcc1l	T	C	19: 42,563,607	S348P	possibly damaging	Het
Rag2	A	T	2: 101,629,615	Q90L	probably benign	Het
Serpini1	A	T	3: 75,614,670	E156V	possibly damaging	Het
Skint4	T	A	4: 112,136,043	I321K	possibly damaging	Het
Slc28a2	A	G	2: 122,455,617	D478G	probably damaging	Het
Sppl2b	G	T	10: 80,865,131	V164F	probably damaging	Het
Traf5	T	A	1: 191,997,509	N527I	probably benign	Het
Ttc3	T	A	16: 94,443,317	D17E	probably benign	Het
Txlnb	G	A	10: 17,806,773	A148T	possibly damaging	Het
Ubtf	A	G	11: 102,310,931	Y256H	probably damaging	Het
Usp25	T	C	16: 77,071,671	F320S	possibly damaging	Het
Utp14b	T	C	1: 78,665,939	V518A	probably benign	Het
Utp20	A	G	10: 88,757,972	V2192A	possibly damaging	Het
Vmn1r173	T	A	7: 23,703,108	M256K	probably benign	Het
Vmn2r114	T	A	17: 23,296,988	M510L	probably benign	Het
Xdh	T	A	17: 73,926,552	Q189L	probably benign	Het
Zfat	C	T	15: 68,180,110	A605T	probably benign	Het

Other mutations in Scel

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00841:Scel	APN	14	103529995	missense	probably benign	0.01
IGL00913:Scel	APN	14	103581809	missense	probably benign	0.35
IGL01086:Scel	APN	14	103612391	missense	probably benign	0.05
IGL01352:Scel	APN	14	103533338	missense	possibly damaging	0.54
IGL01396:Scel	APN	14	103608094	splice site	probably benign
IGL01954:Scel	APN	14	103603242	splice site	probably benign
IGL02064:Scel	APN	14	103533326	missense	probably damaging	0.98
IGL02186:Scel	APN	14	103564821	missense	probably benign	0.23
IGL02475:Scel	APN	14	103537008	missense	possibly damaging	0.95
IGL02926:Scel	APN	14	103576247	nonsense	probably null
IGL03122:Scel	APN	14	103599406	missense	possibly damaging	0.66
IGL03135:Scel	APN	14	103586514	missense	probably benign	0.02
PIT4585001:Scel	UTSW	14	103592368	missense	possibly damaging	0.90
R0346:Scel	UTSW	14	103529984	missense	probably damaging	1.00
R0394:Scel	UTSW	14	103562518	missense	probably benign	0.15
R0418:Scel	UTSW	14	103603254	missense	probably benign
R0635:Scel	UTSW	14	103583139	critical splice donor site	probably null
R0815:Scel	UTSW	14	103586480	missense	possibly damaging	0.83
R0863:Scel	UTSW	14	103586480	missense	possibly damaging	0.83
R0990:Scel	UTSW	14	103581832	missense	possibly damaging	0.55
R1084:Scel	UTSW	14	103564843	critical splice donor site	probably null
R2001:Scel	UTSW	14	103610790	missense	possibly damaging	0.66
R2002:Scel	UTSW	14	103541985	missense	probably damaging	1.00
R2341:Scel	UTSW	14	103608170	missense	possibly damaging	0.92
R3425:Scel	UTSW	14	103608106	missense	possibly damaging	0.92
R3836:Scel	UTSW	14	103592386	missense	possibly damaging	0.66
R4035:Scel	UTSW	14	103530004	missense	probably damaging	1.00
R4197:Scel	UTSW	14	103599400	missense	probably damaging	0.97
R4737:Scel	UTSW	14	103572037	missense	possibly damaging	0.79
R4801:Scel	UTSW	14	103583100	missense	probably benign	0.01
R4802:Scel	UTSW	14	103583100	missense	probably benign	0.01
R5369:Scel	UTSW	14	103586493	missense	probably benign	0.00
R5555:Scel	UTSW	14	103602206	missense	probably benign	0.27
R5582:Scel	UTSW	14	103583139	critical splice donor site	probably benign
R5931:Scel	UTSW	14	103605624	nonsense	probably null
R5978:Scel	UTSW	14	103529254	splice site	probably null
R6045:Scel	UTSW	14	103592213	missense	probably benign	0.12
R6062:Scel	UTSW	14	103585136	missense	possibly damaging	0.82
R6218:Scel	UTSW	14	103572042	missense	probably benign	0.12
R6225:Scel	UTSW	14	103591984	missense	probably benign	0.27
R7102:Scel	UTSW	14	103543832	nonsense	probably null
R7349:Scel	UTSW	14	103543879	missense	probably benign	0.11
R8376:Scel	UTSW	14	103572015	missense	probably benign	0.02
R8924:Scel	UTSW	14	103592371	missense	possibly damaging	0.66
R9014:Scel	UTSW	14	103585139	missense	probably benign
R9130:Scel	UTSW	14	103533310	missense	probably benign	0.05
R9135:Scel	UTSW	14	103602190	missense	probably benign
R9179:Scel	UTSW	14	103574400	missense	possibly damaging	0.79
R9614:Scel	UTSW	14	103605596	missense	probably damaging	1.00
R9638:Scel	UTSW	14	103541973	missense	possibly damaging	0.89
R9672:Scel	UTSW	14	103599402	missense	possibly damaging	0.82
R9719:Scel	UTSW	14	103572006	critical splice acceptor site	probably null
X0026:Scel	UTSW	14	103591993	missense	possibly damaging	0.46

Predicted Primers

PCR Primer
(F):5'- TTGTGCTCTTAGGCACGGAGTAAAG -3'
(R):5'- ATCAGTGTTCTGCCCCAAACCC -3'

Sequencing Primer
(F):5'- GGAGTAAAGCAAATTAACCTTGCC -3'
(R):5'- GGACTAAACCCCTAGTGGTATTC -3'

Posted On

2014-04-24