Incidental Mutation 'R1641:Pi4ka'
ID 173562
Institutional Source Beutler Lab
Gene Symbol Pi4ka
Ensembl Gene ENSMUSG00000041720
Gene Name phosphatidylinositol 4-kinase alpha
Synonyms Pik4ca
MMRRC Submission 039677-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1641 (G1)
Quality Score 225
Status Not validated
Chromosome 16
Chromosomal Location 17280351-17406314 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 17377030 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 168 (V168A)
Ref Sequence ENSEMBL: ENSMUSP00000122550 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036161] [ENSMUST00000154364] [ENSMUST00000232232]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000036161
AA Change: V168A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000036162
Gene: ENSMUSG00000041720
AA Change: V168A

DomainStartEndE-ValueType
low complexity region 198 221 N/A INTRINSIC
low complexity region 243 253 N/A INTRINSIC
SCOP:d1gw5a_ 268 675 2e-3 SMART
low complexity region 895 907 N/A INTRINSIC
PI3Ka 1483 1671 2.11e-54 SMART
Blast:PI3Kc 1688 1762 2e-39 BLAST
PI3Kc 1788 2041 4.04e-106 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128938
Predicted Effect probably benign
Transcript: ENSMUST00000154364
AA Change: V168A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000122550
Gene: ENSMUSG00000041720
AA Change: V168A

DomainStartEndE-ValueType
low complexity region 198 221 N/A INTRINSIC
low complexity region 243 253 N/A INTRINSIC
SCOP:d1gw5a_ 268 675 2e-3 SMART
low complexity region 895 907 N/A INTRINSIC
PI3Ka 1483 1671 2.11e-54 SMART
Blast:PI3Kc 1688 1762 2e-39 BLAST
PI3Kc 1788 2041 4.04e-106 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231419
Predicted Effect probably benign
Transcript: ENSMUST00000232232
AA Change: V168A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phosphatidylinositol (PI) 4-kinase which catalyzes the first committed step in the biosynthesis of phosphatidylinositol 4,5-bisphosphate. The mammalian PI 4-kinases have been classified into two types, II and III, based on their molecular mass, and modulation by detergent and adenosine. The protein encoded by this gene is a type III enzyme that is not inhibited by adenosine. [provided by RefSeq, Sep 2014]
PHENOTYPE: Mice homozygous for a targeted knock-out or knock-in conditionally activated exhibit premature death associated with degeneration of mucosal cells in the stomach and intestines. Mice homozygous for a knock-out allele exhibit early embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,228,959 T2230A probably benign Het
Aasdh T A 5: 76,891,779 T228S probably benign Het
Adamts2 C T 11: 50,792,785 P965S probably damaging Het
Ankrd11 A G 8: 122,891,746 I1768T probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Baz2b A T 2: 59,912,890 L1579Q probably damaging Het
Btbd7 A G 12: 102,790,775 V684A probably damaging Het
Camk1g T A 1: 193,356,357 I86F probably benign Het
Capn13 A T 17: 73,382,894 S41T possibly damaging Het
Cep192 C A 18: 67,847,433 L1422I probably damaging Het
Chaf1a T C 17: 56,047,380 F217L unknown Het
Clca3b A T 3: 144,823,513 M800K possibly damaging Het
Crocc A G 4: 141,017,077 V1836A probably benign Het
Csmd2 G A 4: 128,483,395 V2023M possibly damaging Het
Cul9 A G 17: 46,543,560 V72A possibly damaging Het
Ddx52 T C 11: 83,943,443 probably null Het
Dennd5b A C 6: 149,068,205 V250G probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Gtpbp4 A T 13: 8,973,249 M593K probably benign Het
Il21 A G 3: 37,232,532 F12L probably benign Het
Lrit2 T A 14: 37,069,148 N261K probably benign Het
Lrrc39 G T 3: 116,570,913 C151F probably damaging Het
Lsm14a C A 7: 34,351,374 R426L probably damaging Het
Maml1 G A 11: 50,266,947 P134S probably benign Het
Map3k13 T C 16: 21,903,792 C235R probably damaging Het
Naip2 C T 13: 100,161,981 A516T possibly damaging Het
Nsmaf T C 4: 6,409,884 E663G probably benign Het
Ntrk3 T C 7: 78,356,074 N513S probably damaging Het
Nufip1 T G 14: 76,126,252 N305K possibly damaging Het
Olfr121 C T 17: 37,752,025 T57I possibly damaging Het
Olfr1257 A T 2: 89,881,401 T192S probably benign Het
Olfr575 T A 7: 102,954,968 D218V probably benign Het
Olfr694 T A 7: 106,689,711 T7S probably benign Het
Olfr823 A T 10: 130,112,003 Y262* probably null Het
Prex2 T C 1: 11,231,772 V1433A probably damaging Het
Prl7a1 A T 13: 27,633,629 D217E probably damaging Het
Prr3 G A 17: 35,974,592 R86* probably null Het
Ptprz1 T C 6: 23,049,606 F1350L probably damaging Het
R3hcc1l T C 19: 42,563,607 S348P possibly damaging Het
Rag2 A T 2: 101,629,615 Q90L probably benign Het
Scel T C 14: 103,533,316 L62P probably damaging Het
Serpini1 A T 3: 75,614,670 E156V possibly damaging Het
Skint4 T A 4: 112,136,043 I321K possibly damaging Het
Slc28a2 A G 2: 122,455,617 D478G probably damaging Het
Sppl2b G T 10: 80,865,131 V164F probably damaging Het
Traf5 T A 1: 191,997,509 N527I probably benign Het
Ttc3 T A 16: 94,443,317 D17E probably benign Het
Txlnb G A 10: 17,806,773 A148T possibly damaging Het
Ubtf A G 11: 102,310,931 Y256H probably damaging Het
Usp25 T C 16: 77,071,671 F320S possibly damaging Het
Utp14b T C 1: 78,665,939 V518A probably benign Het
Utp20 A G 10: 88,757,972 V2192A possibly damaging Het
Vmn1r173 T A 7: 23,703,108 M256K probably benign Het
Vmn2r114 T A 17: 23,296,988 M510L probably benign Het
Xdh T A 17: 73,926,552 Q189L probably benign Het
Zfat C T 15: 68,180,110 A605T probably benign Het
Other mutations in Pi4ka
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00580:Pi4ka APN 16 17308144 missense probably benign
IGL00984:Pi4ka APN 16 17358932 nonsense probably null
IGL01066:Pi4ka APN 16 17348773 splice site probably benign
IGL01460:Pi4ka APN 16 17357651 missense probably damaging 1.00
IGL01505:Pi4ka APN 16 17309358 missense probably benign 0.22
IGL01518:Pi4ka APN 16 17280735 missense probably benign 0.03
IGL01533:Pi4ka APN 16 17308201 missense probably benign 0.30
IGL01565:Pi4ka APN 16 17389442 utr 5 prime probably benign
IGL01679:Pi4ka APN 16 17296888 splice site probably benign
IGL01685:Pi4ka APN 16 17325202 missense probably benign 0.09
IGL01734:Pi4ka APN 16 17297260 missense probably benign 0.23
IGL01799:Pi4ka APN 16 17389371 missense probably damaging 1.00
IGL01969:Pi4ka APN 16 17378483 missense probably benign 0.15
IGL02092:Pi4ka APN 16 17318496 missense probably benign 0.00
IGL02113:Pi4ka APN 16 17373415 missense probably benign 0.00
IGL02177:Pi4ka APN 16 17318282 missense probably benign 0.09
IGL02400:Pi4ka APN 16 17293884 missense probably damaging 0.98
IGL02426:Pi4ka APN 16 17378432 splice site probably benign
IGL02474:Pi4ka APN 16 17325429 missense probably damaging 1.00
IGL02587:Pi4ka APN 16 17317353 missense probably damaging 1.00
IGL02667:Pi4ka APN 16 17295461 missense possibly damaging 0.82
IGL02698:Pi4ka APN 16 17291168 missense probably damaging 1.00
IGL02815:Pi4ka APN 16 17358889 splice site probably benign
IGL02828:Pi4ka APN 16 17280711 intron probably benign
IGL02939:Pi4ka APN 16 17354210 missense probably damaging 0.97
IGL03123:Pi4ka APN 16 17282675 missense possibly damaging 0.95
IGL03148:Pi4ka APN 16 17354189 missense probably damaging 0.99
arachnoid UTSW 16 17285281 unclassified probably benign
dove_bar UTSW 16 17326052 splice site probably null
mia UTSW 16 17376982 missense possibly damaging 0.89
Pia UTSW 16 17281044 missense probably damaging 1.00
G1patch:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
IGL03098:Pi4ka UTSW 16 17326027 missense probably damaging 1.00
R0024:Pi4ka UTSW 16 17315535 splice site probably benign
R0054:Pi4ka UTSW 16 17325114 missense probably null 1.00
R0054:Pi4ka UTSW 16 17325114 missense probably null 1.00
R0243:Pi4ka UTSW 16 17297635 missense probably benign 0.44
R0374:Pi4ka UTSW 16 17282932 unclassified probably benign
R0478:Pi4ka UTSW 16 17309311 missense possibly damaging 0.92
R0548:Pi4ka UTSW 16 17307718 missense possibly damaging 0.75
R0626:Pi4ka UTSW 16 17293901 missense probably benign 0.00
R0918:Pi4ka UTSW 16 17285260 missense possibly damaging 0.61
R1082:Pi4ka UTSW 16 17389352 missense probably damaging 1.00
R1384:Pi4ka UTSW 16 17297537 splice site probably benign
R1455:Pi4ka UTSW 16 17363954 missense probably benign 0.02
R1479:Pi4ka UTSW 16 17373400 missense probably benign 0.08
R1490:Pi4ka UTSW 16 17386268 missense probably damaging 1.00
R1565:Pi4ka UTSW 16 17281900 missense probably null
R1594:Pi4ka UTSW 16 17373419 splice site probably benign
R1694:Pi4ka UTSW 16 17295376 missense probably damaging 0.99
R1828:Pi4ka UTSW 16 17280750 missense probably benign 0.00
R1864:Pi4ka UTSW 16 17367525 nonsense probably null
R2036:Pi4ka UTSW 16 17303112 missense probably damaging 1.00
R2151:Pi4ka UTSW 16 17367507 missense probably benign 0.44
R2844:Pi4ka UTSW 16 17350793 missense probably damaging 0.97
R2876:Pi4ka UTSW 16 17367550 missense possibly damaging 0.77
R3953:Pi4ka UTSW 16 17285281 unclassified probably benign
R3972:Pi4ka UTSW 16 17293875 missense probably damaging 1.00
R4357:Pi4ka UTSW 16 17367439 missense probably benign 0.00
R4385:Pi4ka UTSW 16 17386265 missense probably benign 0.13
R4427:Pi4ka UTSW 16 17281044 missense probably damaging 1.00
R4436:Pi4ka UTSW 16 17282382 missense probably damaging 1.00
R4677:Pi4ka UTSW 16 17282373 missense probably damaging 1.00
R4683:Pi4ka UTSW 16 17297037 missense possibly damaging 0.73
R4736:Pi4ka UTSW 16 17377175 missense probably benign 0.12
R4804:Pi4ka UTSW 16 17308161 missense possibly damaging 0.75
R4886:Pi4ka UTSW 16 17358361 missense
R4893:Pi4ka UTSW 16 17377036 missense probably benign 0.21
R4896:Pi4ka UTSW 16 17377169 missense probably damaging 1.00
R5004:Pi4ka UTSW 16 17377169 missense probably damaging 1.00
R5015:Pi4ka UTSW 16 17303082 missense possibly damaging 0.56
R5062:Pi4ka UTSW 16 17309397 missense probably benign 0.02
R5104:Pi4ka UTSW 16 17281050 missense probably damaging 1.00
R5160:Pi4ka UTSW 16 17323053 missense probably benign 0.01
R5173:Pi4ka UTSW 16 17350906 missense possibly damaging 0.95
R5204:Pi4ka UTSW 16 17359045 missense possibly damaging 0.68
R5307:Pi4ka UTSW 16 17323030 missense probably benign 0.00
R5327:Pi4ka UTSW 16 17325413 missense probably damaging 1.00
R5506:Pi4ka UTSW 16 17293953 missense probably damaging 0.96
R5580:Pi4ka UTSW 16 17281087 missense probably damaging 1.00
R5768:Pi4ka UTSW 16 17354872 missense probably benign 0.29
R5857:Pi4ka UTSW 16 17358984 missense probably benign 0.00
R5951:Pi4ka UTSW 16 17303142 missense probably damaging 1.00
R5953:Pi4ka UTSW 16 17281951 missense
R6041:Pi4ka UTSW 16 17360572 missense probably benign
R6223:Pi4ka UTSW 16 17357571 nonsense probably null
R6416:Pi4ka UTSW 16 17358322 missense probably benign 0.22
R6535:Pi4ka UTSW 16 17301036 missense probably damaging 1.00
R6580:Pi4ka UTSW 16 17350830 missense probably damaging 1.00
R6720:Pi4ka UTSW 16 17326052 splice site probably null
R6723:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6725:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6752:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6753:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6755:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6767:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6768:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6782:Pi4ka UTSW 16 17325988 missense probably damaging 1.00
R6782:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6788:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6849:Pi4ka UTSW 16 17303421 missense possibly damaging 0.54
R6958:Pi4ka UTSW 16 17325227 missense probably damaging 1.00
R7014:Pi4ka UTSW 16 17297067 unclassified probably benign
R7055:Pi4ka UTSW 16 17317015 utr 3 prime probably benign
R7317:Pi4ka UTSW 16 17405632 critical splice donor site probably null
R7533:Pi4ka UTSW 16 17297661 missense
R7552:Pi4ka UTSW 16 17291216 missense
R7581:Pi4ka UTSW 16 17301060 missense
R7622:Pi4ka UTSW 16 17293977 missense
R7717:Pi4ka UTSW 16 17376923 missense
R8048:Pi4ka UTSW 16 17303127 missense
R8052:Pi4ka UTSW 16 17356166 missense
R8079:Pi4ka UTSW 16 17303060 missense
R8123:Pi4ka UTSW 16 17281092 missense
R8211:Pi4ka UTSW 16 17282905 missense
R8310:Pi4ka UTSW 16 17354048 critical splice donor site probably null
R8322:Pi4ka UTSW 16 17357573 missense
R8509:Pi4ka UTSW 16 17354144 missense
R8735:Pi4ka UTSW 16 17318370 missense
R8912:Pi4ka UTSW 16 17389366 missense
R8917:Pi4ka UTSW 16 17312446 missense
R8921:Pi4ka UTSW 16 17307740 missense
R8941:Pi4ka UTSW 16 17296943 unclassified probably benign
R9002:Pi4ka UTSW 16 17299453 missense
R9203:Pi4ka UTSW 16 17282301 missense
R9222:Pi4ka UTSW 16 17358361 missense
R9230:Pi4ka UTSW 16 17281924 missense
R9262:Pi4ka UTSW 16 17302995 missense
R9338:Pi4ka UTSW 16 17317363 missense
R9374:Pi4ka UTSW 16 17307710 missense
R9436:Pi4ka UTSW 16 17307806 missense
R9499:Pi4ka UTSW 16 17307710 missense
R9501:Pi4ka UTSW 16 17386292 missense
R9551:Pi4ka UTSW 16 17307710 missense
R9705:Pi4ka UTSW 16 17281951 missense
RF007:Pi4ka UTSW 16 17297233 missense
U24488:Pi4ka UTSW 16 17325176 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GTGCTTACTGAAGTTCTCCTCCCTGA -3'
(R):5'- CTGCTGTGACACCAGTAATGGCATAT -3'

Sequencing Primer
(F):5'- GAGTTCACCCCTGGGAAAG -3'
(R):5'- GCCTTTATAGTCATCACAAGTGGG -3'
Posted On 2014-04-24