Incidental Mutation 'R1641:Chaf1a'
ID173570
Institutional Source Beutler Lab
Gene Symbol Chaf1a
Ensembl Gene ENSMUSG00000002835
Gene Namechromatin assembly factor 1, subunit A (p150)
SynonymsCAF-1
MMRRC Submission 039677-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1641 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location56040416-56068026 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 56047380 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 217 (F217L)
Ref Sequence ENSEMBL: ENSMUSP00000002914 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002914]
PDB Structure
HP1 chromo shadow domain in complex with PXVXL motif of CAF-1 [SOLUTION NMR]
Predicted Effect unknown
Transcript: ENSMUST00000002914
AA Change: F217L
SMART Domains Protein: ENSMUSP00000002914
Gene: ENSMUSG00000002835
AA Change: F217L

DomainStartEndE-ValueType
Pfam:CAF1-p150_N 1 210 3.8e-59 PFAM
low complexity region 263 286 N/A INTRINSIC
Pfam:CAF-1_p150 299 458 1e-49 PFAM
low complexity region 466 481 N/A INTRINSIC
Pfam:CAF1A 537 611 1.1e-25 PFAM
Pfam:CAF1-p150_C2 644 908 1.6e-121 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Chromatin assembly factor I (CAF1) is a nuclear complex consisting of p50, p60 (CHAF1B; MIM 601245), and p150 (CHAF1A) subunits that assembles histone octamers onto replicating DNA in vitro (Kaufman et al., 1995 [PubMed 7600578]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null mutation in this gene display lethality before implantation, embryonic growth arrest, and abnormal heterochromatin morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,228,959 T2230A probably benign Het
Aasdh T A 5: 76,891,779 T228S probably benign Het
Adamts2 C T 11: 50,792,785 P965S probably damaging Het
Ankrd11 A G 8: 122,891,746 I1768T probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Baz2b A T 2: 59,912,890 L1579Q probably damaging Het
Btbd7 A G 12: 102,790,775 V684A probably damaging Het
Camk1g T A 1: 193,356,357 I86F probably benign Het
Capn13 A T 17: 73,382,894 S41T possibly damaging Het
Cep192 C A 18: 67,847,433 L1422I probably damaging Het
Clca3b A T 3: 144,823,513 M800K possibly damaging Het
Crocc A G 4: 141,017,077 V1836A probably benign Het
Csmd2 G A 4: 128,483,395 V2023M possibly damaging Het
Cul9 A G 17: 46,543,560 V72A possibly damaging Het
Ddx52 T C 11: 83,943,443 probably null Het
Dennd5b A C 6: 149,068,205 V250G probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Gtpbp4 A T 13: 8,973,249 M593K probably benign Het
Il21 A G 3: 37,232,532 F12L probably benign Het
Lrit2 T A 14: 37,069,148 N261K probably benign Het
Lrrc39 G T 3: 116,570,913 C151F probably damaging Het
Lsm14a C A 7: 34,351,374 R426L probably damaging Het
Maml1 G A 11: 50,266,947 P134S probably benign Het
Map3k13 T C 16: 21,903,792 C235R probably damaging Het
Naip2 C T 13: 100,161,981 A516T possibly damaging Het
Nsmaf T C 4: 6,409,884 E663G probably benign Het
Ntrk3 T C 7: 78,356,074 N513S probably damaging Het
Nufip1 T G 14: 76,126,252 N305K possibly damaging Het
Olfr121 C T 17: 37,752,025 T57I possibly damaging Het
Olfr1257 A T 2: 89,881,401 T192S probably benign Het
Olfr575 T A 7: 102,954,968 D218V probably benign Het
Olfr694 T A 7: 106,689,711 T7S probably benign Het
Olfr823 A T 10: 130,112,003 Y262* probably null Het
Pi4ka A G 16: 17,377,030 V168A probably benign Het
Prex2 T C 1: 11,231,772 V1433A probably damaging Het
Prl7a1 A T 13: 27,633,629 D217E probably damaging Het
Prr3 G A 17: 35,974,592 R86* probably null Het
Ptprz1 T C 6: 23,049,606 F1350L probably damaging Het
R3hcc1l T C 19: 42,563,607 S348P possibly damaging Het
Rag2 A T 2: 101,629,615 Q90L probably benign Het
Scel T C 14: 103,533,316 L62P probably damaging Het
Serpini1 A T 3: 75,614,670 E156V possibly damaging Het
Skint4 T A 4: 112,136,043 I321K possibly damaging Het
Slc28a2 A G 2: 122,455,617 D478G probably damaging Het
Sppl2b G T 10: 80,865,131 V164F probably damaging Het
Traf5 T A 1: 191,997,509 N527I probably benign Het
Ttc3 T A 16: 94,443,317 D17E probably benign Het
Txlnb G A 10: 17,806,773 A148T possibly damaging Het
Ubtf A G 11: 102,310,931 Y256H probably damaging Het
Usp25 T C 16: 77,071,671 F320S possibly damaging Het
Utp14b T C 1: 78,665,939 V518A probably benign Het
Utp20 A G 10: 88,757,972 V2192A possibly damaging Het
Vmn1r173 T A 7: 23,703,108 M256K probably benign Het
Vmn2r114 T A 17: 23,296,988 M510L probably benign Het
Xdh T A 17: 73,926,552 Q189L probably benign Het
Zfat C T 15: 68,180,110 A605T probably benign Het
Other mutations in Chaf1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01143:Chaf1a APN 17 56063336 missense possibly damaging 0.75
IGL01318:Chaf1a APN 17 56059336 splice site probably benign
IGL01344:Chaf1a APN 17 56064104 missense probably damaging 1.00
IGL02740:Chaf1a APN 17 56067500 missense probably damaging 1.00
IGL03328:Chaf1a APN 17 56063374 missense probably damaging 1.00
R0077:Chaf1a UTSW 17 56047384 missense unknown
R0318:Chaf1a UTSW 17 56062227 missense possibly damaging 0.73
R0945:Chaf1a UTSW 17 56067441 missense probably damaging 1.00
R1370:Chaf1a UTSW 17 56064032 missense probably benign 0.31
R1520:Chaf1a UTSW 17 56047302 missense unknown
R1669:Chaf1a UTSW 17 56063339 missense probably benign 0.45
R1955:Chaf1a UTSW 17 56047540 missense unknown
R2139:Chaf1a UTSW 17 56065226 missense probably damaging 1.00
R2879:Chaf1a UTSW 17 56044114 critical splice donor site probably null
R4258:Chaf1a UTSW 17 56056474 missense unknown
R4303:Chaf1a UTSW 17 56044068 missense unknown
R4577:Chaf1a UTSW 17 56065184 missense probably damaging 1.00
R5254:Chaf1a UTSW 17 56062606 missense probably benign 0.19
R5260:Chaf1a UTSW 17 56065000 missense probably damaging 1.00
R5976:Chaf1a UTSW 17 56064115 missense probably damaging 1.00
R6746:Chaf1a UTSW 17 56063404 missense possibly damaging 0.77
R6799:Chaf1a UTSW 17 56047059 missense unknown
R7327:Chaf1a UTSW 17 56062573 missense probably benign 0.00
R7445:Chaf1a UTSW 17 56062170 missense possibly damaging 0.85
R7565:Chaf1a UTSW 17 56064148 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GACCCCTTCAGACATCACTTGTCAC -3'
(R):5'- TGGGTCACTGACCACACGGTAATC -3'

Sequencing Primer
(F):5'- CATCACTTGTCACATGGAAGAG -3'
(R):5'- ATGGTCCCTCAGGAGAGCTG -3'
Posted On2014-04-24