Incidental Mutation 'R1642:Lamc3'
ID173580
Institutional Source Beutler Lab
Gene Symbol Lamc3
Ensembl Gene ENSMUSG00000026840
Gene Namelaminin gamma 3
Synonyms
MMRRC Submission 039678-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1642 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location31887291-31946539 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 31915996 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 703 (Y703C)
Ref Sequence ENSEMBL: ENSMUSP00000118745 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028187] [ENSMUST00000138325]
Predicted Effect probably damaging
Transcript: ENSMUST00000028187
AA Change: Y703C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028187
Gene: ENSMUSG00000026840
AA Change: Y703C

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
LamNT 38 278 4.32e-115 SMART
EGF_Lam 280 333 4.19e-8 SMART
EGF_Lam 336 389 4.81e-8 SMART
EGF_Lam 392 436 2.52e-11 SMART
EGF_Lam 439 486 1.16e-10 SMART
low complexity region 538 549 N/A INTRINSIC
low complexity region 591 603 N/A INTRINSIC
EGF_like 649 716 3.69e0 SMART
EGF_Lam 719 764 3.1e-11 SMART
EGF_Lam 767 819 3.43e-4 SMART
EGF_Lam 822 875 2.16e-10 SMART
EGF_Lam 878 925 6.29e-12 SMART
EGF_Lam 928 973 1.62e-14 SMART
EGF_Lam 976 1021 1.02e-6 SMART
low complexity region 1032 1046 N/A INTRINSIC
coiled coil region 1119 1150 N/A INTRINSIC
low complexity region 1234 1247 N/A INTRINSIC
low complexity region 1397 1407 N/A INTRINSIC
coiled coil region 1444 1467 N/A INTRINSIC
coiled coil region 1528 1575 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000138325
AA Change: Y703C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118745
Gene: ENSMUSG00000026840
AA Change: Y703C

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
LamNT 38 278 4.32e-115 SMART
EGF_Lam 280 333 4.19e-8 SMART
EGF_Lam 336 389 4.81e-8 SMART
EGF_Lam 392 436 2.52e-11 SMART
EGF_Lam 439 486 1.16e-10 SMART
low complexity region 538 549 N/A INTRINSIC
low complexity region 591 603 N/A INTRINSIC
EGF_like 649 716 3.69e0 SMART
EGF_Lam 719 764 3.1e-11 SMART
EGF_Lam 767 819 3.43e-4 SMART
EGF_Lam 822 875 2.16e-10 SMART
EGF_Lam 878 925 6.29e-12 SMART
EGF_Lam 928 973 1.62e-14 SMART
EGF_Lam 976 1021 1.02e-6 SMART
low complexity region 1032 1046 N/A INTRINSIC
coiled coil region 1119 1150 N/A INTRINSIC
low complexity region 1245 1258 N/A INTRINSIC
low complexity region 1408 1418 N/A INTRINSIC
coiled coil region 1455 1478 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.4%
  • 20x: 89.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins are composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively) and they form a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. Several isoforms of each chain have been described. Different alpha, beta and gamma chain isomers combine to give rise to different heterotrimeric laminin isoforms which are designated by Arabic numerals in the order of their discovery, i.e. alpha1beta1gamma1 heterotrimer is laminin 1. The biological functions of the different chains and trimer molecules are largely unknown, but some of the chains have been shown to differ with respect to their tissue distribution, presumably reflecting diverse functions in vivo. This gene encodes the gamma chain isoform laminin, gamma 3. The gamma 3 chain is most similar to the gamma 1 chain, and contains all the 6 domains expected of the gamma chain. It is a component of laminin 12. The gamma 3 chain is broadly expressed in skin, heart, lung, and the reproductive tracts. In skin, it is seen within the basement membrane of the dermal-epidermal junction at points of nerve penetration. Gamma 3 is also a prominent element of the apical surface of ciliated epithelial cells of lung, oviduct, epididymis, ductus deferens, and seminiferous tubules. The distribution of gamma 3-containing laminins along ciliated epithelial surfaces suggests that the apical laminins are important in the morphogenesis and structural stability of the ciliated processes of these cells. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a reporter allele exhibit abnormal amacrine cell morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057J18Rik A G 10: 28,986,237 V19A probably benign Het
3632451O06Rik T C 14: 49,768,410 probably null Het
4931409K22Rik C A 5: 24,552,688 R177L probably damaging Het
6820408C15Rik T C 2: 152,440,854 Y210H probably damaging Het
Aars T A 8: 111,043,250 I327N possibly damaging Het
Abca6 T A 11: 110,218,281 N688Y possibly damaging Het
Ablim3 T C 18: 61,814,311 K457R probably benign Het
Acsm2 A T 7: 119,563,637 N45Y probably damaging Het
Agxt2 T C 15: 10,373,831 S108P probably damaging Het
Akr1cl A T 1: 65,021,429 M174K probably benign Het
Bfsp1 G A 2: 143,841,763 R214W probably damaging Het
Cby3 A G 11: 50,359,516 D183G probably damaging Het
Clip2 T C 5: 134,503,253 D566G possibly damaging Het
Colgalt1 A G 8: 71,620,757 I341V probably benign Het
Cyp2c38 T A 19: 39,401,709 D349V probably damaging Het
Cyp3a16 T A 5: 145,469,589 I18F unknown Het
Degs2 C T 12: 108,692,192 C176Y probably benign Het
Dhx16 A T 17: 35,891,065 T995S probably damaging Het
Dicer1 A T 12: 104,713,156 C521S probably damaging Het
Dopey2 T C 16: 93,762,315 S532P probably benign Het
Dpysl4 T G 7: 139,090,338 M124R probably damaging Het
Eml6 A G 11: 29,777,001 probably null Het
Erbb4 A T 1: 68,331,234 V395D probably damaging Het
Esf1 T C 2: 140,158,486 D460G possibly damaging Het
F830045P16Rik G A 2: 129,463,714 H247Y probably benign Het
Fsbp T A 4: 11,583,965 S221R probably benign Het
Fstl5 T A 3: 76,410,622 N198K possibly damaging Het
Gemin5 G T 11: 58,139,080 H855Q probably damaging Het
Gjd3 T C 11: 98,982,709 E103G probably benign Het
I0C0044D17Rik A G 4: 98,820,234 probably benign Het
Itgb4 A T 11: 116,007,357 R1646W probably damaging Het
Klri2 A T 6: 129,738,874 C121S probably benign Het
Lrrc10 A G 10: 117,045,883 N154S probably damaging Het
Lrriq1 A G 10: 103,214,456 F812L probably benign Het
Naip2 C T 13: 100,161,981 A516T possibly damaging Het
Nav1 T C 1: 135,452,272 Y1564C probably damaging Het
Ndufc1 T C 3: 51,408,243 T25A probably benign Het
Neurl4 A G 11: 69,903,659 M23V probably benign Het
Nnt A G 13: 119,404,550 probably null Het
Nolc1 G C 19: 46,079,022 probably null Het
Nrg1 A T 8: 31,824,508 M289K probably benign Het
Oas3 G T 5: 120,777,574 H17Q possibly damaging Het
Olfr1030 A G 2: 85,983,857 K6E probably benign Het
Olfr239 A G 17: 33,199,456 Y132C probably damaging Het
Olfr30 A G 11: 58,455,838 I37T probably benign Het
Olfr957 C T 9: 39,511,354 R122H possibly damaging Het
Parp9 T C 16: 35,967,697 Y612H probably benign Het
Pcdh1 A T 18: 38,199,230 M240K possibly damaging Het
Pcdhb9 A G 18: 37,400,934 probably benign Het
Plpp2 A G 10: 79,530,684 V42A probably damaging Het
Ppic C T 18: 53,407,062 V172M probably damaging Het
Ppp1r9b A G 11: 95,001,324 silent Het
Prop1 A G 11: 50,953,325 V27A possibly damaging Het
Psmc5 A G 11: 106,262,416 T295A probably benign Het
Rpa1 A G 11: 75,312,691 probably null Het
Rrp12 A G 19: 41,871,737 F1016L probably damaging Het
Scn2a A T 2: 65,683,697 I242F probably damaging Het
Slco1a6 T A 6: 142,086,434 H655L probably benign Het
Sp140 G A 1: 85,610,824 probably null Het
Syne1 A G 10: 5,348,694 I1071T possibly damaging Het
Tbc1d9b A G 11: 50,149,832 D392G probably damaging Het
Tcaim G A 9: 122,818,773 probably null Het
Tgm3 T A 2: 130,047,782 V632E probably damaging Het
Triobp C A 15: 79,002,148 R1830S probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Vps8 A G 16: 21,581,579 T1266A probably benign Het
Znfx1 T C 2: 167,039,010 I285V possibly damaging Het
Other mutations in Lamc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00582:Lamc3 APN 2 31900581 missense probably damaging 0.99
IGL00823:Lamc3 APN 2 31918521 missense probably damaging 1.00
IGL01020:Lamc3 APN 2 31914656 missense probably benign 0.07
IGL01086:Lamc3 APN 2 31898476 missense probably damaging 1.00
IGL01618:Lamc3 APN 2 31912107 missense probably damaging 0.99
IGL01655:Lamc3 APN 2 31898278 missense probably damaging 1.00
IGL02093:Lamc3 APN 2 31887655 missense probably damaging 1.00
IGL02309:Lamc3 APN 2 31914604 splice site probably benign
IGL02340:Lamc3 APN 2 31918457 missense probably damaging 1.00
IGL02410:Lamc3 APN 2 31905965 missense probably damaging 0.99
IGL02548:Lamc3 APN 2 31920662 missense probably benign 0.00
IGL02679:Lamc3 APN 2 31945398 missense probably benign 0.01
IGL02751:Lamc3 APN 2 31920704 missense probably benign 0.07
IGL02820:Lamc3 APN 2 31923022 missense probably damaging 1.00
IGL02926:Lamc3 APN 2 31935725 splice site probably benign
IGL02926:Lamc3 APN 2 31935726 splice site probably benign
IGL03090:Lamc3 APN 2 31908698 splice site probably benign
IGL03258:Lamc3 APN 2 31887683 missense probably damaging 1.00
R0005:Lamc3 UTSW 2 31922428 missense probably benign 0.07
R0137:Lamc3 UTSW 2 31908616 missense probably damaging 1.00
R0179:Lamc3 UTSW 2 31915084 splice site probably benign
R0244:Lamc3 UTSW 2 31940721 missense probably damaging 1.00
R0512:Lamc3 UTSW 2 31937968 missense probably damaging 1.00
R1052:Lamc3 UTSW 2 31928802 missense probably benign 0.03
R1142:Lamc3 UTSW 2 31940721 missense probably damaging 1.00
R1366:Lamc3 UTSW 2 31928847 missense probably damaging 1.00
R1463:Lamc3 UTSW 2 31887411 missense probably benign
R1515:Lamc3 UTSW 2 31940751 missense probably damaging 1.00
R1692:Lamc3 UTSW 2 31921781 missense probably null 0.01
R1707:Lamc3 UTSW 2 31912129 critical splice donor site probably null
R1714:Lamc3 UTSW 2 31940757 missense probably benign 0.02
R1838:Lamc3 UTSW 2 31925582 missense possibly damaging 0.89
R2940:Lamc3 UTSW 2 31940702 missense probably benign 0.02
R3177:Lamc3 UTSW 2 31908625 missense probably damaging 1.00
R3277:Lamc3 UTSW 2 31908625 missense probably damaging 1.00
R3846:Lamc3 UTSW 2 31924592 missense probably benign 0.01
R4065:Lamc3 UTSW 2 31945258 missense probably benign 0.00
R4089:Lamc3 UTSW 2 31920508 nonsense probably null
R4373:Lamc3 UTSW 2 31898232 missense probably damaging 1.00
R4394:Lamc3 UTSW 2 31931952 missense probably benign
R4395:Lamc3 UTSW 2 31931952 missense probably benign
R4397:Lamc3 UTSW 2 31931952 missense probably benign
R4746:Lamc3 UTSW 2 31905614 missense possibly damaging 0.77
R4948:Lamc3 UTSW 2 31940736 missense probably benign 0.02
R4960:Lamc3 UTSW 2 31915954 missense probably benign 0.00
R5025:Lamc3 UTSW 2 31908669 missense probably benign 0.13
R5062:Lamc3 UTSW 2 31905667 missense possibly damaging 0.60
R5170:Lamc3 UTSW 2 31887344 start codon destroyed probably benign 0.03
R5286:Lamc3 UTSW 2 31918596 missense probably damaging 1.00
R5457:Lamc3 UTSW 2 31931985 missense probably benign
R5655:Lamc3 UTSW 2 31925717 missense probably benign 0.01
R5928:Lamc3 UTSW 2 31921709 missense probably benign 0.00
R6018:Lamc3 UTSW 2 31905712 missense probably damaging 1.00
R6479:Lamc3 UTSW 2 31887401 missense probably benign
R6601:Lamc3 UTSW 2 31920532 missense possibly damaging 0.94
R6920:Lamc3 UTSW 2 31908689 missense probably damaging 1.00
R6924:Lamc3 UTSW 2 31938069 missense probably benign
R7114:Lamc3 UTSW 2 31930645 missense probably damaging 0.99
R7305:Lamc3 UTSW 2 31930702 missense probably benign 0.39
R7559:Lamc3 UTSW 2 31922368 missense probably benign 0.00
R7787:Lamc3 UTSW 2 31900539 missense probably damaging 0.99
R7819:Lamc3 UTSW 2 31921763 missense probably benign
X0010:Lamc3 UTSW 2 31938012 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTATCGACTGGACATGGATGCAGG -3'
(R):5'- TGACTTTTCCAAGCAGTGAGGACAC -3'

Sequencing Primer
(F):5'- ACATGGATGCAGGTCCCC -3'
(R):5'- GTGAACACCCATGAGTTCCTG -3'
Posted On2014-04-24