Mutagenetix > Incidental Mutation

Incidental Mutation 'R1642:Scn2a'

173581

Institutional Source

Beutler Lab

Gene Symbol

Scn2a

Ensembl Gene

ENSMUSG00000075318

Gene Name

sodium channel, voltage-gated, type II, alpha

Synonyms

A230052E19Rik, Scn2a1, Nav1.2

MMRRC Submission

039678-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1642 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

65620771-65767447 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 65683697 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 242 (I242F)

Ref Sequence

ENSEMBL: ENSMUSP00000143882 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028377] [ENSMUST00000100067] [ENSMUST00000144254] [ENSMUST00000200829]

AlphaFold

B1AWN6

Predicted Effect

probably damaging
Transcript: ENSMUST00000028377
AA Change: I242F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000028377
Gene: ENSMUSG00000075318
AA Change: I242F

Domain	Start	End	E-Value	Type
Pfam:Ion_trans	128	436	2.2e-81	PFAM
low complexity region	450	471	N/A	INTRINSIC
Pfam:Na_trans_cytopl	505	710	9.6e-83	PFAM
Pfam:Ion_trans	759	994	3.6e-57	PFAM
Pfam:Na_trans_assoc	998	1204	1.7e-63	PFAM
Pfam:Ion_trans	1208	1484	3.3e-66	PFAM
Pfam:Ion_trans	1531	1788	2.8e-57	PFAM
Pfam:PKD_channel	1627	1782	8.6e-7	PFAM
IQ	1905	1927	3.59e-3	SMART
low complexity region	1967	1975	N/A	INTRINSIC
low complexity region	1981	2000	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000100067
AA Change: I242F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000097645
Gene: ENSMUSG00000075318
AA Change: I242F

Domain	Start	End	E-Value	Type
Pfam:Ion_trans	157	424	3.3e-75	PFAM
low complexity region	433	448	N/A	INTRINSIC
low complexity region	450	471	N/A	INTRINSIC
Pfam:DUF3451	488	711	2.6e-66	PFAM
Pfam:Ion_trans	794	983	1.1e-47	PFAM
Pfam:Na_trans_assoc	998	1219	3.5e-77	PFAM
Pfam:Ion_trans	1245	1473	4.4e-55	PFAM
PDB:1BYY\|A	1475	1527	3e-31	PDB
Pfam:Ion_trans	1566	1776	2.4e-52	PFAM
Pfam:PKD_channel	1628	1783	3.6e-7	PFAM
IQ	1905	1927	3.59e-3	SMART
low complexity region	1967	1975	N/A	INTRINSIC
low complexity region	1981	2000	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138368

Predicted Effect

probably benign
Transcript: ENSMUST00000144254
AA Change: I242F

PolyPhen 2 Score 0.397 (Sensitivity: 0.89; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000117955
Gene: ENSMUSG00000075318
AA Change: I242F

Domain	Start	End	E-Value	Type
Pfam:Ion_trans	128	436	7.2e-81	PFAM
low complexity region	450	471	N/A	INTRINSIC
low complexity region	484	502	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000200829
AA Change: I242F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000143882
Gene: ENSMUSG00000075318
AA Change: I242F

Domain	Start	End	E-Value	Type
Pfam:Ion_trans	128	436	1.2e-79	PFAM
low complexity region	450	471	N/A	INTRINSIC
Pfam:Na_trans_cytopl	505	710	7.1e-80	PFAM
Pfam:Ion_trans	759	994	2.1e-55	PFAM
Pfam:Na_trans_assoc	998	1204	8e-61	PFAM
Pfam:Ion_trans	1208	1484	1.9e-64	PFAM
Pfam:Ion_trans	1531	1788	1.6e-55	PFAM
Pfam:PKD_channel	1627	1782	1.2e-4	PFAM
IQ	1905	1927	1.8e-5	SMART
low complexity region	1967	1975	N/A	INTRINSIC
low complexity region	1981	2000	N/A	INTRINSIC

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.4%
20x: 89.7%

Validation Efficiency

MGI Phenotype

FUNCTION: Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit with four repeat domains, each of which is composed of six membrane-spanning segments, and one or more regulatory beta subunits. Voltage-gated sodium channels are responsible for the generation and propagation of action potentials in neurons and muscle. This gene encodes one member of the sodium channel alpha subunit gene family. In humans, variants of this gene are associated with seizure disorders and autism spectrum disorder. Mice homozygous for a knockout mutation die with severe hypoxia and extensive neuronal cell death, while gain of function mutations result in progressive seizure disorder. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2016]
PHENOTYPE: Homozygotes for a targeted mutation exhibit excess neuronal apoptosis (especially in the brainstem), reduced neuronal sodium channel currents in vitro, and severe hypoxia resulting in neonatal lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310057J18Rik	A	G	10: 28,986,237	V19A	probably benign	Het
3632451O06Rik	T	C	14: 49,768,410		probably null	Het
4931409K22Rik	C	A	5: 24,552,688	R177L	probably damaging	Het
6820408C15Rik	T	C	2: 152,440,854	Y210H	probably damaging	Het
Aars	T	A	8: 111,043,250	I327N	possibly damaging	Het
Abca6	T	A	11: 110,218,281	N688Y	possibly damaging	Het
Ablim3	T	C	18: 61,814,311	K457R	probably benign	Het
Acsm2	A	T	7: 119,563,637	N45Y	probably damaging	Het
Agxt2	T	C	15: 10,373,831	S108P	probably damaging	Het
Akr1cl	A	T	1: 65,021,429	M174K	probably benign	Het
Bfsp1	G	A	2: 143,841,763	R214W	probably damaging	Het
Cby3	A	G	11: 50,359,516	D183G	probably damaging	Het
Clip2	T	C	5: 134,503,253	D566G	possibly damaging	Het
Colgalt1	A	G	8: 71,620,757	I341V	probably benign	Het
Cyp2c38	T	A	19: 39,401,709	D349V	probably damaging	Het
Cyp3a16	T	A	5: 145,469,589	I18F	unknown	Het
Degs2	C	T	12: 108,692,192	C176Y	probably benign	Het
Dhx16	A	T	17: 35,891,065	T995S	probably damaging	Het
Dicer1	A	T	12: 104,713,156	C521S	probably damaging	Het
Dopey2	T	C	16: 93,762,315	S532P	probably benign	Het
Dpysl4	T	G	7: 139,090,338	M124R	probably damaging	Het
Eml6	A	G	11: 29,777,001		probably null	Het
Erbb4	A	T	1: 68,331,234	V395D	probably damaging	Het
Esf1	T	C	2: 140,158,486	D460G	possibly damaging	Het
F830045P16Rik	G	A	2: 129,463,714	H247Y	probably benign	Het
Fsbp	T	A	4: 11,583,965	S221R	probably benign	Het
Fstl5	T	A	3: 76,410,622	N198K	possibly damaging	Het
Gemin5	G	T	11: 58,139,080	H855Q	probably damaging	Het
Gjd3	T	C	11: 98,982,709	E103G	probably benign	Het
I0C0044D17Rik	A	G	4: 98,820,234		probably benign	Het
Itgb4	A	T	11: 116,007,357	R1646W	probably damaging	Het
Klri2	A	T	6: 129,738,874	C121S	probably benign	Het
Lamc3	A	G	2: 31,915,996	Y703C	probably damaging	Het
Lrrc10	A	G	10: 117,045,883	N154S	probably damaging	Het
Lrriq1	A	G	10: 103,214,456	F812L	probably benign	Het
Naip2	C	T	13: 100,161,981	A516T	possibly damaging	Het
Nav1	T	C	1: 135,452,272	Y1564C	probably damaging	Het
Ndufc1	T	C	3: 51,408,243	T25A	probably benign	Het
Neurl4	A	G	11: 69,903,659	M23V	probably benign	Het
Nnt	A	G	13: 119,404,550		probably null	Het
Nolc1	G	C	19: 46,079,022		probably null	Het
Nrg1	A	T	8: 31,824,508	M289K	probably benign	Het
Oas3	G	T	5: 120,777,574	H17Q	possibly damaging	Het
Olfr1030	A	G	2: 85,983,857	K6E	probably benign	Het
Olfr239	A	G	17: 33,199,456	Y132C	probably damaging	Het
Olfr30	A	G	11: 58,455,838	I37T	probably benign	Het
Olfr957	C	T	9: 39,511,354	R122H	possibly damaging	Het
Parp9	T	C	16: 35,967,697	Y612H	probably benign	Het
Pcdh1	A	T	18: 38,199,230	M240K	possibly damaging	Het
Pcdhb9	A	G	18: 37,400,934		probably benign	Het
Plpp2	A	G	10: 79,530,684	V42A	probably damaging	Het
Ppic	C	T	18: 53,407,062	V172M	probably damaging	Het
Ppp1r9b	A	G	11: 95,001,324		silent	Het
Prop1	A	G	11: 50,953,325	V27A	possibly damaging	Het
Psmc5	A	G	11: 106,262,416	T295A	probably benign	Het
Rpa1	A	G	11: 75,312,691		probably null	Het
Rrp12	A	G	19: 41,871,737	F1016L	probably damaging	Het
Slco1a6	T	A	6: 142,086,434	H655L	probably benign	Het
Sp140	G	A	1: 85,610,824		probably null	Het
Syne1	A	G	10: 5,348,694	I1071T	possibly damaging	Het
Tbc1d9b	A	G	11: 50,149,832	D392G	probably damaging	Het
Tcaim	G	A	9: 122,818,773		probably null	Het
Tgm3	T	A	2: 130,047,782	V632E	probably damaging	Het
Triobp	C	A	15: 79,002,148	R1830S	probably damaging	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Vps8	A	G	16: 21,581,579	T1266A	probably benign	Het
Znfx1	T	C	2: 167,039,010	I285V	possibly damaging	Het

Other mutations in Scn2a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00088:Scn2a	APN	2	65764440	missense	probably benign
IGL00159:Scn2a	APN	2	65743090	missense	probably damaging	1.00
IGL00418:Scn2a	APN	2	65764522	missense	probably benign	0.43
IGL00753:Scn2a	APN	2	65683863	missense	possibly damaging	0.66
IGL00770:Scn2a	APN	2	65735853	missense	probably damaging	1.00
IGL00774:Scn2a	APN	2	65735853	missense	probably damaging	1.00
IGL00847:Scn2a	APN	2	65670734	missense	probably damaging	1.00
IGL01155:Scn2a	APN	2	65717748	missense	probably damaging	1.00
IGL01329:Scn2a	APN	2	65717508	missense	probably benign	0.05
IGL01537:Scn2a	APN	2	65715875	missense	probably benign	0.00
IGL01672:Scn2a	APN	2	65751934	missense	probably damaging	1.00
IGL01958:Scn2a	APN	2	65701829	missense	probably damaging	1.00
IGL02028:Scn2a	APN	2	65763658	missense	probably damaging	0.96
IGL02142:Scn2a	APN	2	65715838	missense	probably damaging	1.00
IGL02160:Scn2a	APN	2	65730116	missense	probably damaging	1.00
IGL02183:Scn2a	APN	2	65671603	missense	probably benign	0.20
IGL02341:Scn2a	APN	2	65688377	missense	probably damaging	1.00
IGL02504:Scn2a	APN	2	65683884	missense	probably benign	0.02
IGL02530:Scn2a	APN	2	65730178	missense	probably damaging	0.99
IGL02621:Scn2a	APN	2	65748879	splice site	probably benign
IGL02652:Scn2a	APN	2	65702038	missense	possibly damaging	0.82
IGL02966:Scn2a	APN	2	65701844	missense	possibly damaging	0.93
IGL03188:Scn2a	APN	2	65671653	missense	probably damaging	0.99
IGL03329:Scn2a	APN	2	65764629	missense	probably benign
IGL03336:Scn2a	APN	2	65688744	missense	probably damaging	1.00
IGL03391:Scn2a	APN	2	65764213	missense	probably damaging	1.00
PIT4280001:Scn2a	UTSW	2	65715730	missense	probably damaging	1.00
PIT4362001:Scn2a	UTSW	2	65683838	missense	probably benign	0.09
PIT4403001:Scn2a	UTSW	2	65711908	missense	probably damaging	1.00
PIT4520001:Scn2a	UTSW	2	65688419	missense	probably damaging	1.00
R0021:Scn2a	UTSW	2	65670515	missense	possibly damaging	0.51
R0141:Scn2a	UTSW	2	65711816	missense	probably benign	0.01
R0240:Scn2a	UTSW	2	65735774	missense	probably benign	0.32
R0240:Scn2a	UTSW	2	65735774	missense	probably benign	0.32
R0335:Scn2a	UTSW	2	65682091	missense	probably damaging	1.00
R0508:Scn2a	UTSW	2	65717842	missense	probably damaging	0.99
R0558:Scn2a	UTSW	2	65711925	missense	probably benign	0.26
R0600:Scn2a	UTSW	2	65701833	missense	possibly damaging	0.90
R0667:Scn2a	UTSW	2	65751996	missense	possibly damaging	0.91
R1178:Scn2a	UTSW	2	65686779	splice site	probably benign
R1244:Scn2a	UTSW	2	65763655	missense	probably damaging	0.98
R1386:Scn2a	UTSW	2	65688741	missense	probably damaging	1.00
R1434:Scn2a	UTSW	2	65701991	missense	possibly damaging	0.79
R1440:Scn2a	UTSW	2	65764594	missense	probably benign
R1448:Scn2a	UTSW	2	65683845	missense	probably benign	0.17
R1460:Scn2a	UTSW	2	65701843	missense	probably damaging	0.96
R1553:Scn2a	UTSW	2	65713836	nonsense	probably null
R1803:Scn2a	UTSW	2	65670767	splice site	probably null
R1981:Scn2a	UTSW	2	65690170	missense	probably damaging	1.00
R2002:Scn2a	UTSW	2	65682083	missense	probably null	1.00
R2068:Scn2a	UTSW	2	65752073	missense	probably benign	0.14
R2125:Scn2a	UTSW	2	65752079	nonsense	probably null
R2126:Scn2a	UTSW	2	65752079	nonsense	probably null
R2876:Scn2a	UTSW	2	65715897	missense	possibly damaging	0.64
R2878:Scn2a	UTSW	2	65688371	missense	probably damaging	1.00
R3113:Scn2a	UTSW	2	65748785	missense	possibly damaging	0.86
R3749:Scn2a	UTSW	2	65713771	missense	probably damaging	1.00
R3750:Scn2a	UTSW	2	65713771	missense	probably damaging	1.00
R3765:Scn2a	UTSW	2	65682710	missense	possibly damaging	0.51
R3850:Scn2a	UTSW	2	65682031	missense	probably benign	0.14
R4585:Scn2a	UTSW	2	65743051	splice site	probably null
R4586:Scn2a	UTSW	2	65743051	splice site	probably null
R4588:Scn2a	UTSW	2	65713767	missense	possibly damaging	0.76
R4622:Scn2a	UTSW	2	65752027	missense	probably benign	0.04
R5108:Scn2a	UTSW	2	65688630	missense	probably damaging	1.00
R5161:Scn2a	UTSW	2	65764591	missense	probably benign	0.00
R5235:Scn2a	UTSW	2	65752011	missense	probably damaging	1.00
R5464:Scn2a	UTSW	2	65701756	missense	probably damaging	1.00
R5586:Scn2a	UTSW	2	65707295	nonsense	probably null
R5630:Scn2a	UTSW	2	65726365	missense	probably damaging	1.00
R5715:Scn2a	UTSW	2	65717584	missense	probably benign	0.27
R5730:Scn2a	UTSW	2	65682538	nonsense	probably null
R5734:Scn2a	UTSW	2	65717722	missense	possibly damaging	0.49
R5779:Scn2a	UTSW	2	65764483	missense	probably benign	0.00
R6133:Scn2a	UTSW	2	65743104	missense	probably benign	0.35
R6547:Scn2a	UTSW	2	65715897	missense	probably benign	0.29
R6549:Scn2a	UTSW	2	65764674	missense	probably benign	0.05
R6818:Scn2a	UTSW	2	65688669	nonsense	probably null
R6999:Scn2a	UTSW	2	65682109	missense	probably benign
R7069:Scn2a	UTSW	2	65764606	missense	probably benign	0.00
R7073:Scn2a	UTSW	2	65728443	missense	probably benign	0.00
R7125:Scn2a	UTSW	2	65763933	missense	probably damaging	1.00
R7178:Scn2a	UTSW	2	65748853	nonsense	probably null
R7179:Scn2a	UTSW	2	65701979	missense	probably damaging	1.00
R7203:Scn2a	UTSW	2	65748319	missense	probably benign	0.01
R7227:Scn2a	UTSW	2	65752023	missense	probably damaging	0.98
R7269:Scn2a	UTSW	2	65763769	missense	probably damaging	1.00
R7358:Scn2a	UTSW	2	65682506	nonsense	probably null
R7388:Scn2a	UTSW	2	65688654	missense	probably damaging	1.00
R7491:Scn2a	UTSW	2	65702008	missense	probably damaging	0.99
R7619:Scn2a	UTSW	2	65715903	missense	probably damaging	1.00
R7695:Scn2a	UTSW	2	65711907	missense	probably damaging	0.99
R7735:Scn2a	UTSW	2	65763669	missense	probably benign	0.40
R7911:Scn2a	UTSW	2	65682083	missense	probably null	1.00
R8096:Scn2a	UTSW	2	65764022	missense	probably damaging	0.98
R8333:Scn2a	UTSW	2	65683847	missense	probably benign	0.01
R8416:Scn2a	UTSW	2	65681001	missense	probably benign	0.00
R8850:Scn2a	UTSW	2	65688386	missense	probably damaging	1.00
R8897:Scn2a	UTSW	2	65715658	critical splice acceptor site	probably null
R8977:Scn2a	UTSW	2	65763670	missense	probably damaging	0.99
R8992:Scn2a	UTSW	2	65763898	missense	probably damaging	1.00
R9190:Scn2a	UTSW	2	65681002	missense	probably benign	0.00
R9206:Scn2a	UTSW	2	65717787	missense	probably damaging	1.00
R9355:Scn2a	UTSW	2	65764089	missense	probably damaging	1.00
R9452:Scn2a	UTSW	2	65764819	missense	probably benign
R9529:Scn2a	UTSW	2	65764588	missense	probably damaging	0.99
R9567:Scn2a	UTSW	2	65688630	missense	probably damaging	1.00
R9569:Scn2a	UTSW	2	65730278	missense	probably damaging	1.00
R9657:Scn2a	UTSW	2	65735688	missense	probably damaging	1.00
R9715:Scn2a	UTSW	2	65748805	missense	possibly damaging	0.93
R9761:Scn2a	UTSW	2	65735686	missense	probably damaging	1.00
Z1176:Scn2a	UTSW	2	65751868	missense	possibly damaging	0.84
Z1177:Scn2a	UTSW	2	65717735	missense	probably benign	0.07

Predicted Primers

PCR Primer
(F):5'- TGATCGTCAAGCATGAGTAACACAGTC -3'
(R):5'- AAGGCAGTACCATTCCAATCCAATGAG -3'

Sequencing Primer
(F):5'- CAAGCATGAGTAACACAGTCATTTC -3'
(R):5'- TATTCCTCAGGTTGCCCATG -3'

Posted On

2014-04-24