Incidental Mutation 'R1642:F830045P16Rik'
ID173584
Institutional Source Beutler Lab
Gene Symbol F830045P16Rik
Ensembl Gene ENSMUSG00000043727
Gene NameRIKEN cDNA F830045P16 gene
SynonymsSirpb3
MMRRC Submission 039678-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R1642 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location129458359-129536602 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 129463714 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 247 (H247Y)
Ref Sequence ENSEMBL: ENSMUSP00000058047 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050309]
Predicted Effect probably benign
Transcript: ENSMUST00000050309
AA Change: H247Y

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000058047
Gene: ENSMUSG00000043727
AA Change: H247Y

DomainStartEndE-ValueType
IG_like 51 123 7.95e-2 SMART
IGc1 156 227 5.66e-4 SMART
Pfam:C2-set_2 264 331 1.6e-6 PFAM
IGc1 359 432 2.28e-7 SMART
transmembrane domain 460 482 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.4%
  • 20x: 89.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057J18Rik A G 10: 28,986,237 V19A probably benign Het
3632451O06Rik T C 14: 49,768,410 probably null Het
4931409K22Rik C A 5: 24,552,688 R177L probably damaging Het
6820408C15Rik T C 2: 152,440,854 Y210H probably damaging Het
Aars T A 8: 111,043,250 I327N possibly damaging Het
Abca6 T A 11: 110,218,281 N688Y possibly damaging Het
Ablim3 T C 18: 61,814,311 K457R probably benign Het
Acsm2 A T 7: 119,563,637 N45Y probably damaging Het
Agxt2 T C 15: 10,373,831 S108P probably damaging Het
Akr1cl A T 1: 65,021,429 M174K probably benign Het
Bfsp1 G A 2: 143,841,763 R214W probably damaging Het
Cby3 A G 11: 50,359,516 D183G probably damaging Het
Clip2 T C 5: 134,503,253 D566G possibly damaging Het
Colgalt1 A G 8: 71,620,757 I341V probably benign Het
Cyp2c38 T A 19: 39,401,709 D349V probably damaging Het
Cyp3a16 T A 5: 145,469,589 I18F unknown Het
Degs2 C T 12: 108,692,192 C176Y probably benign Het
Dhx16 A T 17: 35,891,065 T995S probably damaging Het
Dicer1 A T 12: 104,713,156 C521S probably damaging Het
Dopey2 T C 16: 93,762,315 S532P probably benign Het
Dpysl4 T G 7: 139,090,338 M124R probably damaging Het
Eml6 A G 11: 29,777,001 probably null Het
Erbb4 A T 1: 68,331,234 V395D probably damaging Het
Esf1 T C 2: 140,158,486 D460G possibly damaging Het
Fsbp T A 4: 11,583,965 S221R probably benign Het
Fstl5 T A 3: 76,410,622 N198K possibly damaging Het
Gemin5 G T 11: 58,139,080 H855Q probably damaging Het
Gjd3 T C 11: 98,982,709 E103G probably benign Het
I0C0044D17Rik A G 4: 98,820,234 probably benign Het
Itgb4 A T 11: 116,007,357 R1646W probably damaging Het
Klri2 A T 6: 129,738,874 C121S probably benign Het
Lamc3 A G 2: 31,915,996 Y703C probably damaging Het
Lrrc10 A G 10: 117,045,883 N154S probably damaging Het
Lrriq1 A G 10: 103,214,456 F812L probably benign Het
Naip2 C T 13: 100,161,981 A516T possibly damaging Het
Nav1 T C 1: 135,452,272 Y1564C probably damaging Het
Ndufc1 T C 3: 51,408,243 T25A probably benign Het
Neurl4 A G 11: 69,903,659 M23V probably benign Het
Nnt A G 13: 119,404,550 probably null Het
Nolc1 G C 19: 46,079,022 probably null Het
Nrg1 A T 8: 31,824,508 M289K probably benign Het
Oas3 G T 5: 120,777,574 H17Q possibly damaging Het
Olfr1030 A G 2: 85,983,857 K6E probably benign Het
Olfr239 A G 17: 33,199,456 Y132C probably damaging Het
Olfr30 A G 11: 58,455,838 I37T probably benign Het
Olfr957 C T 9: 39,511,354 R122H possibly damaging Het
Parp9 T C 16: 35,967,697 Y612H probably benign Het
Pcdh1 A T 18: 38,199,230 M240K possibly damaging Het
Pcdhb9 A G 18: 37,400,934 probably benign Het
Plpp2 A G 10: 79,530,684 V42A probably damaging Het
Ppic C T 18: 53,407,062 V172M probably damaging Het
Ppp1r9b A G 11: 95,001,324 silent Het
Prop1 A G 11: 50,953,325 V27A possibly damaging Het
Psmc5 A G 11: 106,262,416 T295A probably benign Het
Rpa1 A G 11: 75,312,691 probably null Het
Rrp12 A G 19: 41,871,737 F1016L probably damaging Het
Scn2a A T 2: 65,683,697 I242F probably damaging Het
Slco1a6 T A 6: 142,086,434 H655L probably benign Het
Sp140 G A 1: 85,610,824 probably null Het
Syne1 A G 10: 5,348,694 I1071T possibly damaging Het
Tbc1d9b A G 11: 50,149,832 D392G probably damaging Het
Tcaim G A 9: 122,818,773 probably null Het
Tgm3 T A 2: 130,047,782 V632E probably damaging Het
Triobp C A 15: 79,002,148 R1830S probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Vps8 A G 16: 21,581,579 T1266A probably benign Het
Znfx1 T C 2: 167,039,010 I285V possibly damaging Het
Other mutations in F830045P16Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:F830045P16Rik APN 2 129460529 missense probably damaging 0.97
IGL01149:F830045P16Rik APN 2 129460312 critical splice donor site probably null
IGL01556:F830045P16Rik APN 2 129463720 missense probably benign 0.01
IGL01690:F830045P16Rik APN 2 129472694 missense probably damaging 1.00
IGL02169:F830045P16Rik APN 2 129463572 missense probably damaging 1.00
IGL03194:F830045P16Rik APN 2 129460320 missense possibly damaging 0.91
IGL03231:F830045P16Rik APN 2 129460473 missense probably damaging 1.00
R0062:F830045P16Rik UTSW 2 129463704 missense possibly damaging 0.94
R0062:F830045P16Rik UTSW 2 129463704 missense possibly damaging 0.94
R0234:F830045P16Rik UTSW 2 129463464 missense possibly damaging 0.85
R0234:F830045P16Rik UTSW 2 129463464 missense possibly damaging 0.85
R0333:F830045P16Rik UTSW 2 129472857 missense probably damaging 0.96
R0479:F830045P16Rik UTSW 2 129472688 missense possibly damaging 0.86
R0550:F830045P16Rik UTSW 2 129463509 missense probably damaging 1.00
R0827:F830045P16Rik UTSW 2 129472776 missense probably benign 0.01
R1087:F830045P16Rik UTSW 2 129472719 missense possibly damaging 0.55
R1142:F830045P16Rik UTSW 2 129460332 nonsense probably null
R2022:F830045P16Rik UTSW 2 129472665 missense probably damaging 1.00
R2044:F830045P16Rik UTSW 2 129459397 missense possibly damaging 0.68
R4008:F830045P16Rik UTSW 2 129463547 missense probably damaging 1.00
R4009:F830045P16Rik UTSW 2 129463547 missense probably damaging 1.00
R4011:F830045P16Rik UTSW 2 129463547 missense probably damaging 1.00
R4212:F830045P16Rik UTSW 2 129460353 missense probably benign 0.00
R4579:F830045P16Rik UTSW 2 129463503 missense probably damaging 0.97
R4838:F830045P16Rik UTSW 2 129460550 missense possibly damaging 0.95
R5190:F830045P16Rik UTSW 2 129472715 missense probably benign 0.01
R5217:F830045P16Rik UTSW 2 129463573 missense probably damaging 1.00
R5297:F830045P16Rik UTSW 2 129460553 missense probably benign 0.10
R5352:F830045P16Rik UTSW 2 129472901 missense probably damaging 0.98
R6063:F830045P16Rik UTSW 2 129474390 missense probably damaging 1.00
R6072:F830045P16Rik UTSW 2 129472694 missense probably damaging 1.00
R6173:F830045P16Rik UTSW 2 129463668 missense probably damaging 1.00
R6383:F830045P16Rik UTSW 2 129536438 missense probably benign 0.04
R6386:F830045P16Rik UTSW 2 129472818 missense probably damaging 1.00
R6425:F830045P16Rik UTSW 2 129460580 missense probably damaging 1.00
R6699:F830045P16Rik UTSW 2 129460421 missense probably damaging 0.98
R6869:F830045P16Rik UTSW 2 129474561 missense probably damaging 0.99
R7751:F830045P16Rik UTSW 2 129460447 missense probably damaging 1.00
R8012:F830045P16Rik UTSW 2 129474432 missense possibly damaging 0.92
R8097:F830045P16Rik UTSW 2 129463585 missense possibly damaging 0.55
Z1176:F830045P16Rik UTSW 2 129536530 start gained probably benign
Predicted Primers PCR Primer
(F):5'- CTCCATTGGAGAAGACGTTGGTCTG -3'
(R):5'- TCCGAGAAGAACCTGTTTGCTGTG -3'

Sequencing Primer
(F):5'- GGGTCTGGAGACGGGTG -3'
(R):5'- TGAGATGCACATCCCTTTGG -3'
Posted On2014-04-24