Incidental Mutation 'R1642:Znfx1'
ID 173589
Institutional Source Beutler Lab
Gene Symbol Znfx1
Ensembl Gene ENSMUSG00000039501
Gene Name zinc finger, NFX1-type containing 1
Synonyms
MMRRC Submission 039678-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R1642 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 167035793-167063015 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 167039010 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 285 (I285V)
Ref Sequence ENSEMBL: ENSMUSP00000072867 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018143] [ENSMUST00000048988] [ENSMUST00000067584]
AlphaFold Q8R151
Predicted Effect probably benign
Transcript: ENSMUST00000018143
SMART Domains Protein: ENSMUSP00000018143
Gene: ENSMUSG00000017999

DomainStartEndE-ValueType
low complexity region 20 33 N/A INTRINSIC
coiled coil region 78 106 N/A INTRINSIC
low complexity region 133 148 N/A INTRINSIC
low complexity region 157 166 N/A INTRINSIC
DEXDc 203 404 2.24e-56 SMART
HELICc 443 524 1.71e-29 SMART
coiled coil region 577 613 N/A INTRINSIC
low complexity region 622 629 N/A INTRINSIC
low complexity region 644 657 N/A INTRINSIC
low complexity region 679 692 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000048988
AA Change: I1149V

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000049404
Gene: ENSMUSG00000039501
AA Change: I1149V

DomainStartEndE-ValueType
Pfam:AAA_11 590 855 2.2e-17 PFAM
Pfam:AAA_19 597 684 1.7e-10 PFAM
Pfam:AAA_11 829 1033 1.4e-18 PFAM
Pfam:AAA_12 1044 1228 3.7e-42 PFAM
internal_repeat_2 1281 1374 1.33e-7 PROSPERO
internal_repeat_1 1292 1410 1.32e-16 PROSPERO
low complexity region 1422 1433 N/A INTRINSIC
internal_repeat_1 1434 1547 1.32e-16 PROSPERO
internal_repeat_2 1453 1555 1.33e-7 PROSPERO
Predicted Effect possibly damaging
Transcript: ENSMUST00000067584
AA Change: I285V

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000072867
Gene: ENSMUSG00000039501
AA Change: I285V

DomainStartEndE-ValueType
Pfam:AAA_11 8 170 1.2e-17 PFAM
Pfam:AAA_12 180 364 7.4e-42 PFAM
internal_repeat_2 417 510 1.08e-6 PROSPERO
internal_repeat_1 428 546 1.81e-14 PROSPERO
low complexity region 558 569 N/A INTRINSIC
internal_repeat_1 570 683 1.81e-14 PROSPERO
internal_repeat_2 589 691 1.08e-6 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127468
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.4%
  • 20x: 89.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057J18Rik A G 10: 28,986,237 V19A probably benign Het
3632451O06Rik T C 14: 49,768,410 probably null Het
4931409K22Rik C A 5: 24,552,688 R177L probably damaging Het
6820408C15Rik T C 2: 152,440,854 Y210H probably damaging Het
Aars T A 8: 111,043,250 I327N possibly damaging Het
Abca6 T A 11: 110,218,281 N688Y possibly damaging Het
Ablim3 T C 18: 61,814,311 K457R probably benign Het
Acsm2 A T 7: 119,563,637 N45Y probably damaging Het
Agxt2 T C 15: 10,373,831 S108P probably damaging Het
Akr1cl A T 1: 65,021,429 M174K probably benign Het
Bfsp1 G A 2: 143,841,763 R214W probably damaging Het
Cby3 A G 11: 50,359,516 D183G probably damaging Het
Clip2 T C 5: 134,503,253 D566G possibly damaging Het
Colgalt1 A G 8: 71,620,757 I341V probably benign Het
Cyp2c38 T A 19: 39,401,709 D349V probably damaging Het
Cyp3a16 T A 5: 145,469,589 I18F unknown Het
Degs2 C T 12: 108,692,192 C176Y probably benign Het
Dhx16 A T 17: 35,891,065 T995S probably damaging Het
Dicer1 A T 12: 104,713,156 C521S probably damaging Het
Dopey2 T C 16: 93,762,315 S532P probably benign Het
Dpysl4 T G 7: 139,090,338 M124R probably damaging Het
Eml6 A G 11: 29,777,001 probably null Het
Erbb4 A T 1: 68,331,234 V395D probably damaging Het
Esf1 T C 2: 140,158,486 D460G possibly damaging Het
F830045P16Rik G A 2: 129,463,714 H247Y probably benign Het
Fsbp T A 4: 11,583,965 S221R probably benign Het
Fstl5 T A 3: 76,410,622 N198K possibly damaging Het
Gemin5 G T 11: 58,139,080 H855Q probably damaging Het
Gjd3 T C 11: 98,982,709 E103G probably benign Het
I0C0044D17Rik A G 4: 98,820,234 probably benign Het
Itgb4 A T 11: 116,007,357 R1646W probably damaging Het
Klri2 A T 6: 129,738,874 C121S probably benign Het
Lamc3 A G 2: 31,915,996 Y703C probably damaging Het
Lrrc10 A G 10: 117,045,883 N154S probably damaging Het
Lrriq1 A G 10: 103,214,456 F812L probably benign Het
Naip2 C T 13: 100,161,981 A516T possibly damaging Het
Nav1 T C 1: 135,452,272 Y1564C probably damaging Het
Ndufc1 T C 3: 51,408,243 T25A probably benign Het
Neurl4 A G 11: 69,903,659 M23V probably benign Het
Nnt A G 13: 119,404,550 probably null Het
Nolc1 G C 19: 46,079,022 probably null Het
Nrg1 A T 8: 31,824,508 M289K probably benign Het
Oas3 G T 5: 120,777,574 H17Q possibly damaging Het
Olfr1030 A G 2: 85,983,857 K6E probably benign Het
Olfr239 A G 17: 33,199,456 Y132C probably damaging Het
Olfr30 A G 11: 58,455,838 I37T probably benign Het
Olfr957 C T 9: 39,511,354 R122H possibly damaging Het
Parp9 T C 16: 35,967,697 Y612H probably benign Het
Pcdh1 A T 18: 38,199,230 M240K possibly damaging Het
Pcdhb9 A G 18: 37,400,934 probably benign Het
Plpp2 A G 10: 79,530,684 V42A probably damaging Het
Ppic C T 18: 53,407,062 V172M probably damaging Het
Ppp1r9b A G 11: 95,001,324 silent Het
Prop1 A G 11: 50,953,325 V27A possibly damaging Het
Psmc5 A G 11: 106,262,416 T295A probably benign Het
Rpa1 A G 11: 75,312,691 probably null Het
Rrp12 A G 19: 41,871,737 F1016L probably damaging Het
Scn2a A T 2: 65,683,697 I242F probably damaging Het
Slco1a6 T A 6: 142,086,434 H655L probably benign Het
Sp140 G A 1: 85,610,824 probably null Het
Syne1 A G 10: 5,348,694 I1071T possibly damaging Het
Tbc1d9b A G 11: 50,149,832 D392G probably damaging Het
Tcaim G A 9: 122,818,773 probably null Het
Tgm3 T A 2: 130,047,782 V632E probably damaging Het
Triobp C A 15: 79,002,148 R1830S probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Vps8 A G 16: 21,581,579 T1266A probably benign Het
Other mutations in Znfx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Znfx1 APN 2 167036729 missense possibly damaging 0.65
IGL00492:Znfx1 APN 2 167036923 missense probably damaging 1.00
IGL01285:Znfx1 APN 2 167038695 missense possibly damaging 0.76
IGL01343:Znfx1 APN 2 167037363 missense probably benign 0.16
IGL01767:Znfx1 APN 2 167055723 missense probably damaging 1.00
IGL01983:Znfx1 APN 2 167056350 missense probably damaging 1.00
IGL02006:Znfx1 APN 2 167055763 missense probably damaging 1.00
IGL02254:Znfx1 APN 2 167055723 missense probably damaging 1.00
IGL02421:Znfx1 APN 2 167060080 missense probably damaging 0.97
IGL02496:Znfx1 APN 2 167047630 missense possibly damaging 0.83
IGL02525:Znfx1 APN 2 167037537 missense probably benign 0.00
IGL02528:Znfx1 APN 2 167050404 missense probably benign 0.11
IGL02537:Znfx1 APN 2 167056167 missense probably benign 0.37
IGL03065:Znfx1 APN 2 167055765 missense probably benign 0.00
R0127:Znfx1 UTSW 2 167044210 missense possibly damaging 0.84
R0331:Znfx1 UTSW 2 167046978 missense probably benign 0.11
R0488:Znfx1 UTSW 2 167042563 missense possibly damaging 0.52
R0497:Znfx1 UTSW 2 167055411 missense probably benign 0.03
R0537:Znfx1 UTSW 2 167041701 missense probably damaging 1.00
R0542:Znfx1 UTSW 2 167055655 missense probably damaging 1.00
R0650:Znfx1 UTSW 2 167047654 nonsense probably null
R0655:Znfx1 UTSW 2 167056907 missense probably damaging 1.00
R1104:Znfx1 UTSW 2 167055640 nonsense probably null
R1470:Znfx1 UTSW 2 167042587 missense possibly damaging 0.91
R1470:Znfx1 UTSW 2 167042587 missense possibly damaging 0.91
R1512:Znfx1 UTSW 2 167056317 missense probably benign 0.03
R1533:Znfx1 UTSW 2 167056788 missense probably benign 0.10
R1541:Znfx1 UTSW 2 167056190 missense probably damaging 0.99
R1720:Znfx1 UTSW 2 167044066 nonsense probably null
R1760:Znfx1 UTSW 2 167039866 missense probably damaging 0.96
R1865:Znfx1 UTSW 2 167038809 missense probably damaging 1.00
R1959:Znfx1 UTSW 2 167050350 missense probably damaging 1.00
R2088:Znfx1 UTSW 2 167055810 missense probably damaging 1.00
R4581:Znfx1 UTSW 2 167050316 missense probably damaging 1.00
R4622:Znfx1 UTSW 2 167041753 missense possibly damaging 0.91
R4649:Znfx1 UTSW 2 167056356 missense probably benign 0.08
R4685:Znfx1 UTSW 2 167039030 missense probably damaging 1.00
R4798:Znfx1 UTSW 2 167038569 splice site probably null
R4827:Znfx1 UTSW 2 167044231 missense possibly damaging 0.77
R4870:Znfx1 UTSW 2 167055269 missense probably benign
R4910:Znfx1 UTSW 2 167036804 missense probably damaging 1.00
R4910:Znfx1 UTSW 2 167037482 missense probably benign 0.00
R5022:Znfx1 UTSW 2 167039826 missense probably damaging 1.00
R5023:Znfx1 UTSW 2 167039826 missense probably damaging 1.00
R5057:Znfx1 UTSW 2 167039826 missense probably damaging 1.00
R5061:Znfx1 UTSW 2 167065398 unclassified probably benign
R5119:Znfx1 UTSW 2 167065387 unclassified probably benign
R5125:Znfx1 UTSW 2 167046939 missense possibly damaging 0.81
R5896:Znfx1 UTSW 2 167039000 missense probably damaging 1.00
R6107:Znfx1 UTSW 2 167037081 missense possibly damaging 0.67
R6112:Znfx1 UTSW 2 167038206 missense probably benign
R6158:Znfx1 UTSW 2 167056726 missense probably benign 0.19
R6281:Znfx1 UTSW 2 167055885 missense probably damaging 1.00
R6464:Znfx1 UTSW 2 167046922 missense probably benign 0.34
R6749:Znfx1 UTSW 2 167056599 missense probably benign 0.00
R6888:Znfx1 UTSW 2 167038940 missense possibly damaging 0.91
R6973:Znfx1 UTSW 2 167056761 missense probably benign 0.18
R7017:Znfx1 UTSW 2 167048534 missense probably damaging 1.00
R7138:Znfx1 UTSW 2 167056777 missense probably benign 0.03
R7192:Znfx1 UTSW 2 167042190 missense probably benign 0.00
R7426:Znfx1 UTSW 2 167048555 missense probably damaging 1.00
R7431:Znfx1 UTSW 2 167055792 missense probably damaging 1.00
R7473:Znfx1 UTSW 2 167038824 missense probably damaging 1.00
R7593:Znfx1 UTSW 2 167056225 missense probably benign 0.28
R7732:Znfx1 UTSW 2 167042669 missense possibly damaging 0.91
R7835:Znfx1 UTSW 2 167039827 missense probably damaging 1.00
R7993:Znfx1 UTSW 2 167055937 nonsense probably null
R8154:Znfx1 UTSW 2 167055237 missense probably damaging 1.00
R8351:Znfx1 UTSW 2 167055655 missense probably damaging 1.00
R8790:Znfx1 UTSW 2 167050580 intron probably benign
R8953:Znfx1 UTSW 2 167055501 missense probably damaging 1.00
R9005:Znfx1 UTSW 2 167038736 missense
R9131:Znfx1 UTSW 2 167050378 missense probably benign
R9163:Znfx1 UTSW 2 167056341 missense probably damaging 1.00
R9169:Znfx1 UTSW 2 167055265 missense probably benign
R9181:Znfx1 UTSW 2 167037818 missense probably damaging 1.00
R9181:Znfx1 UTSW 2 167038217 missense probably benign 0.06
R9300:Znfx1 UTSW 2 167055940 missense probably damaging 1.00
R9448:Znfx1 UTSW 2 167046924 missense probably benign 0.04
R9569:Znfx1 UTSW 2 167055955 missense
X0064:Znfx1 UTSW 2 167055256 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATGTTCCCAATGCAGTACATCCCC -3'
(R):5'- TCAGTGTCCAGAGATGACGTGCAG -3'

Sequencing Primer
(F):5'- AATGCAGTACATCCCCTTCTTGG -3'
(R):5'- TGCACAGCACGGGTGAG -3'
Posted On 2014-04-24