Mutagenetix > Incidental Mutation

Incidental Mutation 'R1642:Znfx1'

173589

Institutional Source

Beutler Lab

Gene Symbol

Znfx1

Ensembl Gene

ENSMUSG00000039501

Gene Name

zinc finger, NFX1-type containing 1

Synonyms

MMRRC Submission

039678-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1642 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

167035793-167063015 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 167039010 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 285 (I285V)

Ref Sequence

ENSEMBL: ENSMUSP00000072867 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018143] [ENSMUST00000048988] [ENSMUST00000067584]

AlphaFold

Q8R151

Predicted Effect

probably benign
Transcript: ENSMUST00000018143

SMART Domains

Protein: ENSMUSP00000018143
Gene: ENSMUSG00000017999

Domain	Start	End	E-Value	Type
low complexity region	20	33	N/A	INTRINSIC
coiled coil region	78	106	N/A	INTRINSIC
low complexity region	133	148	N/A	INTRINSIC
low complexity region	157	166	N/A	INTRINSIC
DEXDc	203	404	2.24e-56	SMART
HELICc	443	524	1.71e-29	SMART
coiled coil region	577	613	N/A	INTRINSIC
low complexity region	622	629	N/A	INTRINSIC
low complexity region	644	657	N/A	INTRINSIC
low complexity region	679	692	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000048988
AA Change: I1149V

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000049404
Gene: ENSMUSG00000039501
AA Change: I1149V

Domain	Start	End	E-Value	Type
Pfam:AAA_11	590	855	2.2e-17	PFAM
Pfam:AAA_19	597	684	1.7e-10	PFAM
Pfam:AAA_11	829	1033	1.4e-18	PFAM
Pfam:AAA_12	1044	1228	3.7e-42	PFAM
internal_repeat_2	1281	1374	1.33e-7	PROSPERO
internal_repeat_1	1292	1410	1.32e-16	PROSPERO
low complexity region	1422	1433	N/A	INTRINSIC
internal_repeat_1	1434	1547	1.32e-16	PROSPERO
internal_repeat_2	1453	1555	1.33e-7	PROSPERO

Predicted Effect

possibly damaging
Transcript: ENSMUST00000067584
AA Change: I285V

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000072867
Gene: ENSMUSG00000039501
AA Change: I285V

Domain	Start	End	E-Value	Type
Pfam:AAA_11	8	170	1.2e-17	PFAM
Pfam:AAA_12	180	364	7.4e-42	PFAM
internal_repeat_2	417	510	1.08e-6	PROSPERO
internal_repeat_1	428	546	1.81e-14	PROSPERO
low complexity region	558	569	N/A	INTRINSIC
internal_repeat_1	570	683	1.81e-14	PROSPERO
internal_repeat_2	589	691	1.08e-6	PROSPERO

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127468

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.4%
20x: 89.7%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310057J18Rik	A	G	10: 28,986,237	V19A	probably benign	Het
3632451O06Rik	T	C	14: 49,768,410		probably null	Het
4931409K22Rik	C	A	5: 24,552,688	R177L	probably damaging	Het
6820408C15Rik	T	C	2: 152,440,854	Y210H	probably damaging	Het
Aars	T	A	8: 111,043,250	I327N	possibly damaging	Het
Abca6	T	A	11: 110,218,281	N688Y	possibly damaging	Het
Ablim3	T	C	18: 61,814,311	K457R	probably benign	Het
Acsm2	A	T	7: 119,563,637	N45Y	probably damaging	Het
Agxt2	T	C	15: 10,373,831	S108P	probably damaging	Het
Akr1cl	A	T	1: 65,021,429	M174K	probably benign	Het
Bfsp1	G	A	2: 143,841,763	R214W	probably damaging	Het
Cby3	A	G	11: 50,359,516	D183G	probably damaging	Het
Clip2	T	C	5: 134,503,253	D566G	possibly damaging	Het
Colgalt1	A	G	8: 71,620,757	I341V	probably benign	Het
Cyp2c38	T	A	19: 39,401,709	D349V	probably damaging	Het
Cyp3a16	T	A	5: 145,469,589	I18F	unknown	Het
Degs2	C	T	12: 108,692,192	C176Y	probably benign	Het
Dhx16	A	T	17: 35,891,065	T995S	probably damaging	Het
Dicer1	A	T	12: 104,713,156	C521S	probably damaging	Het
Dopey2	T	C	16: 93,762,315	S532P	probably benign	Het
Dpysl4	T	G	7: 139,090,338	M124R	probably damaging	Het
Eml6	A	G	11: 29,777,001		probably null	Het
Erbb4	A	T	1: 68,331,234	V395D	probably damaging	Het
Esf1	T	C	2: 140,158,486	D460G	possibly damaging	Het
F830045P16Rik	G	A	2: 129,463,714	H247Y	probably benign	Het
Fsbp	T	A	4: 11,583,965	S221R	probably benign	Het
Fstl5	T	A	3: 76,410,622	N198K	possibly damaging	Het
Gemin5	G	T	11: 58,139,080	H855Q	probably damaging	Het
Gjd3	T	C	11: 98,982,709	E103G	probably benign	Het
I0C0044D17Rik	A	G	4: 98,820,234		probably benign	Het
Itgb4	A	T	11: 116,007,357	R1646W	probably damaging	Het
Klri2	A	T	6: 129,738,874	C121S	probably benign	Het
Lamc3	A	G	2: 31,915,996	Y703C	probably damaging	Het
Lrrc10	A	G	10: 117,045,883	N154S	probably damaging	Het
Lrriq1	A	G	10: 103,214,456	F812L	probably benign	Het
Naip2	C	T	13: 100,161,981	A516T	possibly damaging	Het
Nav1	T	C	1: 135,452,272	Y1564C	probably damaging	Het
Ndufc1	T	C	3: 51,408,243	T25A	probably benign	Het
Neurl4	A	G	11: 69,903,659	M23V	probably benign	Het
Nnt	A	G	13: 119,404,550		probably null	Het
Nolc1	G	C	19: 46,079,022		probably null	Het
Nrg1	A	T	8: 31,824,508	M289K	probably benign	Het
Oas3	G	T	5: 120,777,574	H17Q	possibly damaging	Het
Olfr1030	A	G	2: 85,983,857	K6E	probably benign	Het
Olfr239	A	G	17: 33,199,456	Y132C	probably damaging	Het
Olfr30	A	G	11: 58,455,838	I37T	probably benign	Het
Olfr957	C	T	9: 39,511,354	R122H	possibly damaging	Het
Parp9	T	C	16: 35,967,697	Y612H	probably benign	Het
Pcdh1	A	T	18: 38,199,230	M240K	possibly damaging	Het
Pcdhb9	A	G	18: 37,400,934		probably benign	Het
Plpp2	A	G	10: 79,530,684	V42A	probably damaging	Het
Ppic	C	T	18: 53,407,062	V172M	probably damaging	Het
Ppp1r9b	A	G	11: 95,001,324		silent	Het
Prop1	A	G	11: 50,953,325	V27A	possibly damaging	Het
Psmc5	A	G	11: 106,262,416	T295A	probably benign	Het
Rpa1	A	G	11: 75,312,691		probably null	Het
Rrp12	A	G	19: 41,871,737	F1016L	probably damaging	Het
Scn2a	A	T	2: 65,683,697	I242F	probably damaging	Het
Slco1a6	T	A	6: 142,086,434	H655L	probably benign	Het
Sp140	G	A	1: 85,610,824		probably null	Het
Syne1	A	G	10: 5,348,694	I1071T	possibly damaging	Het
Tbc1d9b	A	G	11: 50,149,832	D392G	probably damaging	Het
Tcaim	G	A	9: 122,818,773		probably null	Het
Tgm3	T	A	2: 130,047,782	V632E	probably damaging	Het
Triobp	C	A	15: 79,002,148	R1830S	probably damaging	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Vps8	A	G	16: 21,581,579	T1266A	probably benign	Het

Other mutations in Znfx1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00324:Znfx1	APN	2	167036729	missense	possibly damaging	0.65
IGL00492:Znfx1	APN	2	167036923	missense	probably damaging	1.00
IGL01285:Znfx1	APN	2	167038695	missense	possibly damaging	0.76
IGL01343:Znfx1	APN	2	167037363	missense	probably benign	0.16
IGL01767:Znfx1	APN	2	167055723	missense	probably damaging	1.00
IGL01983:Znfx1	APN	2	167056350	missense	probably damaging	1.00
IGL02006:Znfx1	APN	2	167055763	missense	probably damaging	1.00
IGL02254:Znfx1	APN	2	167055723	missense	probably damaging	1.00
IGL02421:Znfx1	APN	2	167060080	missense	probably damaging	0.97
IGL02496:Znfx1	APN	2	167047630	missense	possibly damaging	0.83
IGL02525:Znfx1	APN	2	167037537	missense	probably benign	0.00
IGL02528:Znfx1	APN	2	167050404	missense	probably benign	0.11
IGL02537:Znfx1	APN	2	167056167	missense	probably benign	0.37
IGL03065:Znfx1	APN	2	167055765	missense	probably benign	0.00
R0127:Znfx1	UTSW	2	167044210	missense	possibly damaging	0.84
R0331:Znfx1	UTSW	2	167046978	missense	probably benign	0.11
R0488:Znfx1	UTSW	2	167042563	missense	possibly damaging	0.52
R0497:Znfx1	UTSW	2	167055411	missense	probably benign	0.03
R0537:Znfx1	UTSW	2	167041701	missense	probably damaging	1.00
R0542:Znfx1	UTSW	2	167055655	missense	probably damaging	1.00
R0650:Znfx1	UTSW	2	167047654	nonsense	probably null
R0655:Znfx1	UTSW	2	167056907	missense	probably damaging	1.00
R1104:Znfx1	UTSW	2	167055640	nonsense	probably null
R1470:Znfx1	UTSW	2	167042587	missense	possibly damaging	0.91
R1470:Znfx1	UTSW	2	167042587	missense	possibly damaging	0.91
R1512:Znfx1	UTSW	2	167056317	missense	probably benign	0.03
R1533:Znfx1	UTSW	2	167056788	missense	probably benign	0.10
R1541:Znfx1	UTSW	2	167056190	missense	probably damaging	0.99
R1720:Znfx1	UTSW	2	167044066	nonsense	probably null
R1760:Znfx1	UTSW	2	167039866	missense	probably damaging	0.96
R1865:Znfx1	UTSW	2	167038809	missense	probably damaging	1.00
R1959:Znfx1	UTSW	2	167050350	missense	probably damaging	1.00
R2088:Znfx1	UTSW	2	167055810	missense	probably damaging	1.00
R4581:Znfx1	UTSW	2	167050316	missense	probably damaging	1.00
R4622:Znfx1	UTSW	2	167041753	missense	possibly damaging	0.91
R4649:Znfx1	UTSW	2	167056356	missense	probably benign	0.08
R4685:Znfx1	UTSW	2	167039030	missense	probably damaging	1.00
R4798:Znfx1	UTSW	2	167038569	splice site	probably null
R4827:Znfx1	UTSW	2	167044231	missense	possibly damaging	0.77
R4870:Znfx1	UTSW	2	167055269	missense	probably benign
R4910:Znfx1	UTSW	2	167036804	missense	probably damaging	1.00
R4910:Znfx1	UTSW	2	167037482	missense	probably benign	0.00
R5022:Znfx1	UTSW	2	167039826	missense	probably damaging	1.00
R5023:Znfx1	UTSW	2	167039826	missense	probably damaging	1.00
R5057:Znfx1	UTSW	2	167039826	missense	probably damaging	1.00
R5061:Znfx1	UTSW	2	167065398	unclassified	probably benign
R5119:Znfx1	UTSW	2	167065387	unclassified	probably benign
R5125:Znfx1	UTSW	2	167046939	missense	possibly damaging	0.81
R5896:Znfx1	UTSW	2	167039000	missense	probably damaging	1.00
R6107:Znfx1	UTSW	2	167037081	missense	possibly damaging	0.67
R6112:Znfx1	UTSW	2	167038206	missense	probably benign
R6158:Znfx1	UTSW	2	167056726	missense	probably benign	0.19
R6281:Znfx1	UTSW	2	167055885	missense	probably damaging	1.00
R6464:Znfx1	UTSW	2	167046922	missense	probably benign	0.34
R6749:Znfx1	UTSW	2	167056599	missense	probably benign	0.00
R6888:Znfx1	UTSW	2	167038940	missense	possibly damaging	0.91
R6973:Znfx1	UTSW	2	167056761	missense	probably benign	0.18
R7017:Znfx1	UTSW	2	167048534	missense	probably damaging	1.00
R7138:Znfx1	UTSW	2	167056777	missense	probably benign	0.03
R7192:Znfx1	UTSW	2	167042190	missense	probably benign	0.00
R7426:Znfx1	UTSW	2	167048555	missense	probably damaging	1.00
R7431:Znfx1	UTSW	2	167055792	missense	probably damaging	1.00
R7473:Znfx1	UTSW	2	167038824	missense	probably damaging	1.00
R7593:Znfx1	UTSW	2	167056225	missense	probably benign	0.28
R7732:Znfx1	UTSW	2	167042669	missense	possibly damaging	0.91
R7835:Znfx1	UTSW	2	167039827	missense	probably damaging	1.00
R7993:Znfx1	UTSW	2	167055937	nonsense	probably null
R8154:Znfx1	UTSW	2	167055237	missense	probably damaging	1.00
R8351:Znfx1	UTSW	2	167055655	missense	probably damaging	1.00
R8790:Znfx1	UTSW	2	167050580	intron	probably benign
R8953:Znfx1	UTSW	2	167055501	missense	probably damaging	1.00
R9005:Znfx1	UTSW	2	167038736	missense
R9131:Znfx1	UTSW	2	167050378	missense	probably benign
R9163:Znfx1	UTSW	2	167056341	missense	probably damaging	1.00
R9169:Znfx1	UTSW	2	167055265	missense	probably benign
R9181:Znfx1	UTSW	2	167037818	missense	probably damaging	1.00
R9181:Znfx1	UTSW	2	167038217	missense	probably benign	0.06
R9300:Znfx1	UTSW	2	167055940	missense	probably damaging	1.00
R9448:Znfx1	UTSW	2	167046924	missense	probably benign	0.04
R9569:Znfx1	UTSW	2	167055955	missense
X0064:Znfx1	UTSW	2	167055256	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CATGTTCCCAATGCAGTACATCCCC -3'
(R):5'- TCAGTGTCCAGAGATGACGTGCAG -3'

Sequencing Primer
(F):5'- AATGCAGTACATCCCCTTCTTGG -3'
(R):5'- TGCACAGCACGGGTGAG -3'

Posted On

2014-04-24