Mutagenetix > Incidental Mutations

Incidental Mutation 'R1642:Clip2'

173597

Institutional Source

Beutler Lab

Gene Symbol

Clip2

Ensembl Gene

ENSMUSG00000063146

Gene Name

CAP-GLY domain containing linker protein 2

Synonyms

WSCR4, Cyln2, CLIP-115

MMRRC Submission

039678-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.337) question?

Stock #

R1642 (G1)

Quality Score

137

Status

Not validated

Chromosome

Chromosomal Location

134489383-134552434 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 134503253 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 566 (D566G)

Ref Sequence

ENSEMBL: ENSMUSP00000098212 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000036999] [ENSMUST00000100647]

Predicted Effect

probably benign
Transcript: ENSMUST00000036999
AA Change: D531G

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000037431
Gene: ENSMUSG00000063146
AA Change: D531G

Domain	Start	End	E-Value	Type
low complexity region	17	39	N/A	INTRINSIC
low complexity region	49	62	N/A	INTRINSIC
CAP_GLY	82	147	2.72e-30	SMART
CAP_GLY	222	287	1.15e-33	SMART
low complexity region	315	339	N/A	INTRINSIC
coiled coil region	355	457	N/A	INTRINSIC
low complexity region	504	519	N/A	INTRINSIC
coiled coil region	529	578	N/A	INTRINSIC
coiled coil region	640	982	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000100647
AA Change: D566G

PolyPhen 2 Score 0.889 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000098212
Gene: ENSMUSG00000063146
AA Change: D566G

Domain	Start	End	E-Value	Type
low complexity region	17	39	N/A	INTRINSIC
low complexity region	49	62	N/A	INTRINSIC
CAP_GLY	82	147	2.72e-30	SMART
CAP_GLY	222	287	1.15e-33	SMART
low complexity region	315	339	N/A	INTRINSIC
coiled coil region	355	496	N/A	INTRINSIC
low complexity region	539	554	N/A	INTRINSIC
coiled coil region	564	613	N/A	INTRINSIC
coiled coil region	675	1017	N/A	INTRINSIC

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.4%
20x: 89.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of cytoplasmic linker proteins, which have been proposed to mediate the interaction between specific membranous organelles and microtubules. This protein was found to associate with both microtubules and an organelle called the dendritic lamellar body. This gene is hemizygously deleted in Williams syndrome, a multisystem developmental disorder caused by the deletion of contiguous genes at 7q11.23. Alternative splicing of this gene generates 2 transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous and heterozygous for disruptions in this gene display growth deficiency, brain abnormalities and hippocampal dysfunction and deficits in motor coordination. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310057J18Rik	A	G	10: 28,986,237	V19A	probably benign	Het
3632451O06Rik	T	C	14: 49,768,410		probably null	Het
4931409K22Rik	C	A	5: 24,552,688	R177L	probably damaging	Het
6820408C15Rik	T	C	2: 152,440,854	Y210H	probably damaging	Het
Aars	T	A	8: 111,043,250	I327N	possibly damaging	Het
Abca6	T	A	11: 110,218,281	N688Y	possibly damaging	Het
Ablim3	T	C	18: 61,814,311	K457R	probably benign	Het
Acsm2	A	T	7: 119,563,637	N45Y	probably damaging	Het
Agxt2	T	C	15: 10,373,831	S108P	probably damaging	Het
Akr1cl	A	T	1: 65,021,429	M174K	probably benign	Het
Bfsp1	G	A	2: 143,841,763	R214W	probably damaging	Het
Cby3	A	G	11: 50,359,516	D183G	probably damaging	Het
Colgalt1	A	G	8: 71,620,757	I341V	probably benign	Het
Cyp2c38	T	A	19: 39,401,709	D349V	probably damaging	Het
Cyp3a16	T	A	5: 145,469,589	I18F	unknown	Het
Degs2	C	T	12: 108,692,192	C176Y	probably benign	Het
Dhx16	A	T	17: 35,891,065	T995S	probably damaging	Het
Dicer1	A	T	12: 104,713,156	C521S	probably damaging	Het
Dopey2	T	C	16: 93,762,315	S532P	probably benign	Het
Dpysl4	T	G	7: 139,090,338	M124R	probably damaging	Het
Eml6	A	G	11: 29,777,001		probably null	Het
Erbb4	A	T	1: 68,331,234	V395D	probably damaging	Het
Esf1	T	C	2: 140,158,486	D460G	possibly damaging	Het
F830045P16Rik	G	A	2: 129,463,714	H247Y	probably benign	Het
Fsbp	T	A	4: 11,583,965	S221R	probably benign	Het
Fstl5	T	A	3: 76,410,622	N198K	possibly damaging	Het
Gemin5	G	T	11: 58,139,080	H855Q	probably damaging	Het
Gjd3	T	C	11: 98,982,709	E103G	probably benign	Het
I0C0044D17Rik	A	G	4: 98,820,234		probably benign	Het
Itgb4	A	T	11: 116,007,357	R1646W	probably damaging	Het
Klri2	A	T	6: 129,738,874	C121S	probably benign	Het
Lamc3	A	G	2: 31,915,996	Y703C	probably damaging	Het
Lrrc10	A	G	10: 117,045,883	N154S	probably damaging	Het
Lrriq1	A	G	10: 103,214,456	F812L	probably benign	Het
Naip2	C	T	13: 100,161,981	A516T	possibly damaging	Het
Nav1	T	C	1: 135,452,272	Y1564C	probably damaging	Het
Ndufc1	T	C	3: 51,408,243	T25A	probably benign	Het
Neurl4	A	G	11: 69,903,659	M23V	probably benign	Het
Nnt	A	G	13: 119,404,550		probably null	Het
Nolc1	G	C	19: 46,079,022		probably null	Het
Nrg1	A	T	8: 31,824,508	M289K	probably benign	Het
Oas3	G	T	5: 120,777,574	H17Q	possibly damaging	Het
Olfr1030	A	G	2: 85,983,857	K6E	probably benign	Het
Olfr239	A	G	17: 33,199,456	Y132C	probably damaging	Het
Olfr30	A	G	11: 58,455,838	I37T	probably benign	Het
Olfr957	C	T	9: 39,511,354	R122H	possibly damaging	Het
Parp9	T	C	16: 35,967,697	Y612H	probably benign	Het
Pcdh1	A	T	18: 38,199,230	M240K	possibly damaging	Het
Pcdhb9	A	G	18: 37,400,934		probably benign	Het
Plpp2	A	G	10: 79,530,684	V42A	probably damaging	Het
Ppic	C	T	18: 53,407,062	V172M	probably damaging	Het
Ppp1r9b	A	G	11: 95,001,324		silent	Het
Prop1	A	G	11: 50,953,325	V27A	possibly damaging	Het
Psmc5	A	G	11: 106,262,416	T295A	probably benign	Het
Rpa1	A	G	11: 75,312,691		probably null	Het
Rrp12	A	G	19: 41,871,737	F1016L	probably damaging	Het
Scn2a	A	T	2: 65,683,697	I242F	probably damaging	Het
Slco1a6	T	A	6: 142,086,434	H655L	probably benign	Het
Sp140	G	A	1: 85,610,824		probably null	Het
Syne1	A	G	10: 5,348,694	I1071T	possibly damaging	Het
Tbc1d9b	A	G	11: 50,149,832	D392G	probably damaging	Het
Tcaim	G	A	9: 122,818,773		probably null	Het
Tgm3	T	A	2: 130,047,782	V632E	probably damaging	Het
Triobp	C	A	15: 79,002,148	R1830S	probably damaging	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Vps8	A	G	16: 21,581,579	T1266A	probably benign	Het
Znfx1	T	C	2: 167,039,010	I285V	possibly damaging	Het

Other mutations in Clip2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00500:Clip2	APN	5	134500157	splice site	probably benign
IGL01024:Clip2	APN	5	134510212	missense	probably damaging	1.00
IGL01103:Clip2	APN	5	134492350	missense	possibly damaging	0.64
IGL01726:Clip2	APN	5	134522664	missense	probably damaging	1.00
IGL01833:Clip2	APN	5	134498084	splice site	probably benign
IGL02174:Clip2	APN	5	134494264	missense	probably damaging	1.00
IGL02232:Clip2	APN	5	134503130	missense	probably damaging	1.00
IGL02271:Clip2	APN	5	134502571	missense	probably benign	0.35
IGL02471:Clip2	APN	5	134518022	missense	probably benign	0.04
IGL02690:Clip2	APN	5	134510159	splice site	probably benign
IGL03198:Clip2	APN	5	134498082	splice site	probably benign
IGL03269:Clip2	APN	5	134516894	missense	probably damaging	1.00
R0335:Clip2	UTSW	5	134535215	start gained	probably benign
R0422:Clip2	UTSW	5	134498113	missense	probably benign	0.04
R0519:Clip2	UTSW	5	134516151	missense	probably benign	0.01
R1169:Clip2	UTSW	5	134492250	missense	probably benign	0.36
R1718:Clip2	UTSW	5	134502929	nonsense	probably null
R1822:Clip2	UTSW	5	134503227	missense	probably benign	0.01
R1824:Clip2	UTSW	5	134503227	missense	probably benign	0.01
R2011:Clip2	UTSW	5	134503115	missense	probably damaging	1.00
R3106:Clip2	UTSW	5	134523064	missense	probably benign	0.12
R3890:Clip2	UTSW	5	134522993	missense	probably damaging	1.00
R3891:Clip2	UTSW	5	134522993	missense	probably damaging	1.00
R3892:Clip2	UTSW	5	134522993	missense	probably damaging	1.00
R4134:Clip2	UTSW	5	134492253	missense	probably benign	0.08
R4237:Clip2	UTSW	5	134535197	start gained	probably benign
R4239:Clip2	UTSW	5	134535197	start gained	probably benign
R4294:Clip2	UTSW	5	134492313	missense	probably benign	0.09
R4450:Clip2	UTSW	5	134502953	missense	possibly damaging	0.82
R4741:Clip2	UTSW	5	134516269	missense	probably benign	0.02
R5186:Clip2	UTSW	5	134522791	missense	possibly damaging	0.46
R5235:Clip2	UTSW	5	134522791	missense	possibly damaging	0.46
R5409:Clip2	UTSW	5	134522791	missense	possibly damaging	0.46
R5410:Clip2	UTSW	5	134522791	missense	possibly damaging	0.46
R5448:Clip2	UTSW	5	134514048	missense	probably benign	0.01
R5900:Clip2	UTSW	5	134502779	missense	possibly damaging	0.48
R6464:Clip2	UTSW	5	134491925	missense	probably benign	0.00
R7032:Clip2	UTSW	5	134522630	missense	probably damaging	1.00
R7152:Clip2	UTSW	5	134496241	missense	probably damaging	1.00
R7216:Clip2	UTSW	5	134502917	missense	probably benign	0.01
R7358:Clip2	UTSW	5	134502630	nonsense	probably null
R7725:Clip2	UTSW	5	134517999	nonsense	probably null
X0062:Clip2	UTSW	5	134503136	missense	probably benign	0.12
Z1177:Clip2	UTSW	5	134516835	missense	probably damaging	0.98
Z1177:Clip2	UTSW	5	134522999	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GATTTCCAGTTGTCCATGAGCCCC -3'
(R):5'- TGAGAACAGCTAGTACCCAGCTAGG -3'

Sequencing Primer
(F):5'- ATGAGCCCCATGTTTTCCG -3'
(R):5'- TACCCAGCTAGGGATAGGTGC -3'

Posted On

2014-04-24