Incidental Mutation 'R1642:Olfr957'
ID173607
Institutional Source Beutler Lab
Gene Symbol Olfr957
Ensembl Gene ENSMUSG00000095322
Gene Nameolfactory receptor 957
SynonymsGA_x6K02T2PVTD-33208209-33207274, MOR171-12
MMRRC Submission 039678-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.117) question?
Stock #R1642 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location39510234-39515809 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 39511354 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 122 (R122H)
Ref Sequence ENSEMBL: ENSMUSP00000149559 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051653] [ENSMUST00000216177]
Predicted Effect possibly damaging
Transcript: ENSMUST00000051653
AA Change: R122H

PolyPhen 2 Score 0.781 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000054536
Gene: ENSMUSG00000095322
AA Change: R122H

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.8e-50 PFAM
Pfam:7tm_1 41 290 3.8e-19 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000216177
AA Change: R122H

PolyPhen 2 Score 0.781 (Sensitivity: 0.85; Specificity: 0.93)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.4%
  • 20x: 89.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057J18Rik A G 10: 28,986,237 V19A probably benign Het
3632451O06Rik T C 14: 49,768,410 probably null Het
4931409K22Rik C A 5: 24,552,688 R177L probably damaging Het
6820408C15Rik T C 2: 152,440,854 Y210H probably damaging Het
Aars T A 8: 111,043,250 I327N possibly damaging Het
Abca6 T A 11: 110,218,281 N688Y possibly damaging Het
Ablim3 T C 18: 61,814,311 K457R probably benign Het
Acsm2 A T 7: 119,563,637 N45Y probably damaging Het
Agxt2 T C 15: 10,373,831 S108P probably damaging Het
Akr1cl A T 1: 65,021,429 M174K probably benign Het
Bfsp1 G A 2: 143,841,763 R214W probably damaging Het
Cby3 A G 11: 50,359,516 D183G probably damaging Het
Clip2 T C 5: 134,503,253 D566G possibly damaging Het
Colgalt1 A G 8: 71,620,757 I341V probably benign Het
Cyp2c38 T A 19: 39,401,709 D349V probably damaging Het
Cyp3a16 T A 5: 145,469,589 I18F unknown Het
Degs2 C T 12: 108,692,192 C176Y probably benign Het
Dhx16 A T 17: 35,891,065 T995S probably damaging Het
Dicer1 A T 12: 104,713,156 C521S probably damaging Het
Dopey2 T C 16: 93,762,315 S532P probably benign Het
Dpysl4 T G 7: 139,090,338 M124R probably damaging Het
Eml6 A G 11: 29,777,001 probably null Het
Erbb4 A T 1: 68,331,234 V395D probably damaging Het
Esf1 T C 2: 140,158,486 D460G possibly damaging Het
F830045P16Rik G A 2: 129,463,714 H247Y probably benign Het
Fsbp T A 4: 11,583,965 S221R probably benign Het
Fstl5 T A 3: 76,410,622 N198K possibly damaging Het
Gemin5 G T 11: 58,139,080 H855Q probably damaging Het
Gjd3 T C 11: 98,982,709 E103G probably benign Het
I0C0044D17Rik A G 4: 98,820,234 probably benign Het
Itgb4 A T 11: 116,007,357 R1646W probably damaging Het
Klri2 A T 6: 129,738,874 C121S probably benign Het
Lamc3 A G 2: 31,915,996 Y703C probably damaging Het
Lrrc10 A G 10: 117,045,883 N154S probably damaging Het
Lrriq1 A G 10: 103,214,456 F812L probably benign Het
Naip2 C T 13: 100,161,981 A516T possibly damaging Het
Nav1 T C 1: 135,452,272 Y1564C probably damaging Het
Ndufc1 T C 3: 51,408,243 T25A probably benign Het
Neurl4 A G 11: 69,903,659 M23V probably benign Het
Nnt A G 13: 119,404,550 probably null Het
Nolc1 G C 19: 46,079,022 probably null Het
Nrg1 A T 8: 31,824,508 M289K probably benign Het
Oas3 G T 5: 120,777,574 H17Q possibly damaging Het
Olfr1030 A G 2: 85,983,857 K6E probably benign Het
Olfr239 A G 17: 33,199,456 Y132C probably damaging Het
Olfr30 A G 11: 58,455,838 I37T probably benign Het
Parp9 T C 16: 35,967,697 Y612H probably benign Het
Pcdh1 A T 18: 38,199,230 M240K possibly damaging Het
Pcdhb9 A G 18: 37,400,934 probably benign Het
Plpp2 A G 10: 79,530,684 V42A probably damaging Het
Ppic C T 18: 53,407,062 V172M probably damaging Het
Ppp1r9b A G 11: 95,001,324 silent Het
Prop1 A G 11: 50,953,325 V27A possibly damaging Het
Psmc5 A G 11: 106,262,416 T295A probably benign Het
Rpa1 A G 11: 75,312,691 probably null Het
Rrp12 A G 19: 41,871,737 F1016L probably damaging Het
Scn2a A T 2: 65,683,697 I242F probably damaging Het
Slco1a6 T A 6: 142,086,434 H655L probably benign Het
Sp140 G A 1: 85,610,824 probably null Het
Syne1 A G 10: 5,348,694 I1071T possibly damaging Het
Tbc1d9b A G 11: 50,149,832 D392G probably damaging Het
Tcaim G A 9: 122,818,773 probably null Het
Tgm3 T A 2: 130,047,782 V632E probably damaging Het
Triobp C A 15: 79,002,148 R1830S probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Vps8 A G 16: 21,581,579 T1266A probably benign Het
Znfx1 T C 2: 167,039,010 I285V possibly damaging Het
Other mutations in Olfr957
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01520:Olfr957 APN 9 39511046 missense possibly damaging 0.64
R0603:Olfr957 UTSW 9 39511514 missense possibly damaging 0.76
R2044:Olfr957 UTSW 9 39511378 missense probably damaging 0.99
R2182:Olfr957 UTSW 9 39511426 missense probably damaging 1.00
R2290:Olfr957 UTSW 9 39511678 missense possibly damaging 0.87
R4246:Olfr957 UTSW 9 39511603 missense probably benign 0.31
R4248:Olfr957 UTSW 9 39511603 missense probably benign 0.31
R5273:Olfr957 UTSW 9 39511499 missense possibly damaging 0.95
R5495:Olfr957 UTSW 9 39511145 missense probably benign 0.39
R5718:Olfr957 UTSW 9 39511042 missense probably damaging 1.00
R5827:Olfr957 UTSW 9 39511058 missense probably damaging 1.00
R6261:Olfr957 UTSW 9 39510809 missense probably benign
R6917:Olfr957 UTSW 9 39511199 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCTTCAGTGGAAGGAATGCG -3'
(R):5'- TGCCAGTCCAGTGTCATCATGC -3'

Sequencing Primer
(F):5'- GAACTGAAGGACAGTCCTAGTATTTC -3'
(R):5'- TGTCATCATGCCCAAAATGCTG -3'
Posted On2014-04-24