Incidental Mutation 'R1642:Syne1'
ID173609
Institutional Source Beutler Lab
Gene Symbol Syne1
Ensembl Gene ENSMUSG00000096054
Gene Namespectrin repeat containing, nuclear envelope 1
SynonymsA330049M09Rik, enaptin165, SYNE-1, nesprin-1, C130039F11Rik
MMRRC Submission 039678-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1642 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location5020917-5551482 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 5348694 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 1071 (I1071T)
Ref Sequence ENSEMBL: ENSMUSP00000150262 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041639] [ENSMUST00000215295]
Predicted Effect possibly damaging
Transcript: ENSMUST00000041639
AA Change: I1071T

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000039440
Gene: ENSMUSG00000096054
AA Change: I1071T

DomainStartEndE-ValueType
CH 29 139 4.55e-14 SMART
low complexity region 145 167 N/A INTRINSIC
CH 187 285 9.67e-18 SMART
coiled coil region 425 452 N/A INTRINSIC
Blast:SPEC 493 599 2e-28 BLAST
Blast:SPEC 606 695 7e-40 BLAST
Blast:SPEC 701 815 1e-32 BLAST
Blast:SPEC 815 913 4e-41 BLAST
Blast:SPEC 920 1013 9e-53 BLAST
Blast:SPEC 1117 1219 2e-60 BLAST
coiled coil region 1267 1329 N/A INTRINSIC
low complexity region 1349 1368 N/A INTRINSIC
coiled coil region 1399 1427 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000215295
AA Change: I1071T

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215887
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.4%
  • 20x: 89.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a spectrin repeat containing protein expressed in skeletal and smooth muscle, and peripheral blood lymphocytes, that localizes to the nuclear membrane. Mutations in this gene have been associated with autosomal recessive spinocerebellar ataxia 8, also referred to as autosomal recessive cerebellar ataxia type 1 or recessive ataxia of Beauce. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an allele lacking the KASH domain exhibit neonatal and postnatal lethality, progressive muscular dystrophy, and limb weakness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057J18Rik A G 10: 28,986,237 V19A probably benign Het
3632451O06Rik T C 14: 49,768,410 probably null Het
4931409K22Rik C A 5: 24,552,688 R177L probably damaging Het
6820408C15Rik T C 2: 152,440,854 Y210H probably damaging Het
Aars T A 8: 111,043,250 I327N possibly damaging Het
Abca6 T A 11: 110,218,281 N688Y possibly damaging Het
Ablim3 T C 18: 61,814,311 K457R probably benign Het
Acsm2 A T 7: 119,563,637 N45Y probably damaging Het
Agxt2 T C 15: 10,373,831 S108P probably damaging Het
Akr1cl A T 1: 65,021,429 M174K probably benign Het
Bfsp1 G A 2: 143,841,763 R214W probably damaging Het
Cby3 A G 11: 50,359,516 D183G probably damaging Het
Clip2 T C 5: 134,503,253 D566G possibly damaging Het
Colgalt1 A G 8: 71,620,757 I341V probably benign Het
Cyp2c38 T A 19: 39,401,709 D349V probably damaging Het
Cyp3a16 T A 5: 145,469,589 I18F unknown Het
Degs2 C T 12: 108,692,192 C176Y probably benign Het
Dhx16 A T 17: 35,891,065 T995S probably damaging Het
Dicer1 A T 12: 104,713,156 C521S probably damaging Het
Dopey2 T C 16: 93,762,315 S532P probably benign Het
Dpysl4 T G 7: 139,090,338 M124R probably damaging Het
Eml6 A G 11: 29,777,001 probably null Het
Erbb4 A T 1: 68,331,234 V395D probably damaging Het
Esf1 T C 2: 140,158,486 D460G possibly damaging Het
F830045P16Rik G A 2: 129,463,714 H247Y probably benign Het
Fsbp T A 4: 11,583,965 S221R probably benign Het
Fstl5 T A 3: 76,410,622 N198K possibly damaging Het
Gemin5 G T 11: 58,139,080 H855Q probably damaging Het
Gjd3 T C 11: 98,982,709 E103G probably benign Het
I0C0044D17Rik A G 4: 98,820,234 probably benign Het
Itgb4 A T 11: 116,007,357 R1646W probably damaging Het
Klri2 A T 6: 129,738,874 C121S probably benign Het
Lamc3 A G 2: 31,915,996 Y703C probably damaging Het
Lrrc10 A G 10: 117,045,883 N154S probably damaging Het
Lrriq1 A G 10: 103,214,456 F812L probably benign Het
Naip2 C T 13: 100,161,981 A516T possibly damaging Het
Nav1 T C 1: 135,452,272 Y1564C probably damaging Het
Ndufc1 T C 3: 51,408,243 T25A probably benign Het
Neurl4 A G 11: 69,903,659 M23V probably benign Het
Nnt A G 13: 119,404,550 probably null Het
Nolc1 G C 19: 46,079,022 probably null Het
Nrg1 A T 8: 31,824,508 M289K probably benign Het
Oas3 G T 5: 120,777,574 H17Q possibly damaging Het
Olfr1030 A G 2: 85,983,857 K6E probably benign Het
Olfr239 A G 17: 33,199,456 Y132C probably damaging Het
Olfr30 A G 11: 58,455,838 I37T probably benign Het
Olfr957 C T 9: 39,511,354 R122H possibly damaging Het
Parp9 T C 16: 35,967,697 Y612H probably benign Het
Pcdh1 A T 18: 38,199,230 M240K possibly damaging Het
Pcdhb9 A G 18: 37,400,934 probably benign Het
Plpp2 A G 10: 79,530,684 V42A probably damaging Het
Ppic C T 18: 53,407,062 V172M probably damaging Het
Ppp1r9b A G 11: 95,001,324 silent Het
Prop1 A G 11: 50,953,325 V27A possibly damaging Het
Psmc5 A G 11: 106,262,416 T295A probably benign Het
Rpa1 A G 11: 75,312,691 probably null Het
Rrp12 A G 19: 41,871,737 F1016L probably damaging Het
Scn2a A T 2: 65,683,697 I242F probably damaging Het
Slco1a6 T A 6: 142,086,434 H655L probably benign Het
Sp140 G A 1: 85,610,824 probably null Het
Tbc1d9b A G 11: 50,149,832 D392G probably damaging Het
Tcaim G A 9: 122,818,773 probably null Het
Tgm3 T A 2: 130,047,782 V632E probably damaging Het
Triobp C A 15: 79,002,148 R1830S probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Vps8 A G 16: 21,581,579 T1266A probably benign Het
Znfx1 T C 2: 167,039,010 I285V possibly damaging Het
Other mutations in Syne1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00684:Syne1 APN 10 5342167 synonymous probably benign
IGL00725:Syne1 APN 10 5344922 missense possibly damaging 0.48
IGL00799:Syne1 APN 10 5347878 missense probably benign 0.00
IGL01087:Syne1 APN 10 5425708 missense probably damaging 1.00
IGL01123:Syne1 APN 10 5344921 nonsense probably null
IGL01147:Syne1 APN 10 5052691 nonsense probably null
IGL01150:Syne1 APN 10 5443154 missense probably damaging 1.00
IGL01154:Syne1 APN 10 5360848 missense probably damaging 1.00
IGL01727:Syne1 APN 10 5047842 missense probably damaging 0.99
IGL01761:Syne1 APN 10 5405456 missense probably damaging 1.00
IGL01793:Syne1 APN 10 5352191 missense possibly damaging 0.67
IGL01961:Syne1 APN 10 5043723 missense possibly damaging 0.94
IGL01975:Syne1 APN 10 5068908 intron probably benign
IGL02152:Syne1 APN 10 5424382 missense probably damaging 1.00
IGL02423:Syne1 APN 10 5368295 missense probably benign 0.00
IGL02457:Syne1 APN 10 5342167 missense probably damaging 1.00
IGL02543:Syne1 APN 10 5043618 missense probably damaging 0.97
IGL02836:Syne1 APN 10 5409875 splice site probably benign
IGL03141:Syne1 APN 10 5424261 missense probably damaging 1.00
FR4548:Syne1 UTSW 10 5032969 missense probably benign 0.09
IGL02799:Syne1 UTSW 10 5359059 missense probably damaging 1.00
PIT4305001:Syne1 UTSW 10 5333023 missense probably damaging 1.00
PIT4687001:Syne1 UTSW 10 5358390 missense possibly damaging 0.87
R0004:Syne1 UTSW 10 5443132 splice site probably benign
R0110:Syne1 UTSW 10 5367600 missense probably damaging 1.00
R0165:Syne1 UTSW 10 5033096 missense probably benign 0.28
R0194:Syne1 UTSW 10 5424311 missense probably benign
R0311:Syne1 UTSW 10 5348943 missense possibly damaging 0.92
R0328:Syne1 UTSW 10 5348945 missense possibly damaging 0.62
R0379:Syne1 UTSW 10 5541989 missense probably damaging 1.00
R0387:Syne1 UTSW 10 5351029 missense probably benign
R0452:Syne1 UTSW 10 5405435 missense probably damaging 0.98
R0456:Syne1 UTSW 10 5342252 missense probably benign 0.04
R0457:Syne1 UTSW 10 5022041 missense probably damaging 1.00
R0469:Syne1 UTSW 10 5367600 missense probably damaging 1.00
R0510:Syne1 UTSW 10 5367600 missense probably damaging 1.00
R0533:Syne1 UTSW 10 5358438 missense probably benign 0.00
R0617:Syne1 UTSW 10 5350933 missense probably damaging 1.00
R0690:Syne1 UTSW 10 5033138 splice site probably benign
R0964:Syne1 UTSW 10 5043652 missense possibly damaging 0.95
R1133:Syne1 UTSW 10 5349044 missense possibly damaging 0.77
R1327:Syne1 UTSW 10 5048925 splice site probably benign
R1339:Syne1 UTSW 10 5367571 missense probably damaging 1.00
R1531:Syne1 UTSW 10 5347875 nonsense probably null
R1558:Syne1 UTSW 10 5349280 nonsense probably null
R1633:Syne1 UTSW 10 5349388 missense probably damaging 1.00
R1658:Syne1 UTSW 10 5367616 missense probably benign 0.03
R1753:Syne1 UTSW 10 5367621 missense probably benign 0.28
R1759:Syne1 UTSW 10 5349369 missense probably damaging 1.00
R1792:Syne1 UTSW 10 5040975 missense probably damaging 1.00
R2076:Syne1 UTSW 10 5040897 missense probably damaging 0.99
R2079:Syne1 UTSW 10 5361502 missense probably benign 0.01
R2102:Syne1 UTSW 10 5056514 missense probably damaging 1.00
R2233:Syne1 UTSW 10 5041484 missense probably benign 0.01
R2305:Syne1 UTSW 10 5047573 missense probably damaging 0.97
R3435:Syne1 UTSW 10 5348565 missense probably damaging 1.00
R3749:Syne1 UTSW 10 5052267 splice site probably benign
R3876:Syne1 UTSW 10 5052345 missense possibly damaging 0.57
R3895:Syne1 UTSW 10 5405456 missense probably damaging 0.98
R3974:Syne1 UTSW 10 5043630 missense probably benign 0.06
R4042:Syne1 UTSW 10 5041584 missense probably benign 0.21
R4120:Syne1 UTSW 10 5409798 missense probably damaging 1.00
R4201:Syne1 UTSW 10 5347870 missense probably benign
R4364:Syne1 UTSW 10 5353987 missense probably damaging 0.96
R4498:Syne1 UTSW 10 5031768 missense probably benign 0.00
R4767:Syne1 UTSW 10 5344866 nonsense probably null
R4804:Syne1 UTSW 10 5349310 missense possibly damaging 0.95
R4917:Syne1 UTSW 10 5057909 missense probably damaging 1.00
R4930:Syne1 UTSW 10 5052777 missense probably damaging 0.99
R5081:Syne1 UTSW 10 5047767 missense probably benign 0.04
R5089:Syne1 UTSW 10 5405444 nonsense probably null
R5174:Syne1 UTSW 10 5041490 missense probably damaging 0.99
R5205:Syne1 UTSW 10 5052295 missense probably benign 0.05
R5303:Syne1 UTSW 10 5420464 missense probably benign 0.00
R5384:Syne1 UTSW 10 5041494 missense probably benign 0.00
R5385:Syne1 UTSW 10 5041494 missense probably benign 0.00
R5392:Syne1 UTSW 10 5348661 missense probably damaging 1.00
R5442:Syne1 UTSW 10 5343473 missense probably benign 0.09
R5750:Syne1 UTSW 10 5339209 missense probably benign 0.01
R5935:Syne1 UTSW 10 5360706 unclassified probably null
R6015:Syne1 UTSW 10 5346819 critical splice donor site probably null
R6023:Syne1 UTSW 10 5443223 missense probably benign 0.09
R6049:Syne1 UTSW 10 5347926 missense possibly damaging 0.79
R6084:Syne1 UTSW 10 5348994 missense probably damaging 1.00
R6145:Syne1 UTSW 10 5052750 missense probably damaging 1.00
R6164:Syne1 UTSW 10 5061429 missense probably damaging 1.00
R6165:Syne1 UTSW 10 5425678 missense probably damaging 1.00
R6198:Syne1 UTSW 10 5302269 missense probably damaging 0.99
R6217:Syne1 UTSW 10 5293761 missense probably benign 0.00
R6247:Syne1 UTSW 10 5349071 missense probably damaging 0.98
R6271:Syne1 UTSW 10 5234652 missense probably damaging 1.00
R6338:Syne1 UTSW 10 5255475 missense probably benign 0.00
R6344:Syne1 UTSW 10 5022212 missense probably benign 0.08
R6434:Syne1 UTSW 10 5318422 missense probably benign 0.01
R6476:Syne1 UTSW 10 5154531 missense possibly damaging 0.88
R6479:Syne1 UTSW 10 5231679 nonsense probably null
R6479:Syne1 UTSW 10 5456826 missense probably damaging 1.00
R6546:Syne1 UTSW 10 5218645 nonsense probably null
R6578:Syne1 UTSW 10 5405454 nonsense probably null
R6611:Syne1 UTSW 10 5045273 missense probably benign 0.01
R6615:Syne1 UTSW 10 5301340 missense probably damaging 0.98
R6632:Syne1 UTSW 10 5215667 critical splice donor site probably null
R6662:Syne1 UTSW 10 5128416 missense probably damaging 1.00
R6677:Syne1 UTSW 10 5040942 missense possibly damaging 0.82
R6764:Syne1 UTSW 10 5229011 nonsense probably null
R6765:Syne1 UTSW 10 5143285 intron probably null
R6778:Syne1 UTSW 10 5102406 missense probably damaging 0.97
R6851:Syne1 UTSW 10 5262703 nonsense probably null
R6878:Syne1 UTSW 10 5420388 missense possibly damaging 0.78
R6883:Syne1 UTSW 10 5231704 nonsense probably null
R6910:Syne1 UTSW 10 5048887 missense probably benign 0.01
R6916:Syne1 UTSW 10 5227912 missense probably benign 0.00
R6925:Syne1 UTSW 10 5126682 missense probably benign 0.00
R6943:Syne1 UTSW 10 5083940 missense probably benign
R6947:Syne1 UTSW 10 5175789 missense probably damaging 1.00
R6965:Syne1 UTSW 10 5229120 missense possibly damaging 0.66
R6968:Syne1 UTSW 10 5117041 missense probably benign 0.09
R7043:Syne1 UTSW 10 5072193 missense possibly damaging 0.77
R7059:Syne1 UTSW 10 5346859 missense probably damaging 1.00
R7067:Syne1 UTSW 10 5234586 missense probably damaging 1.00
R7087:Syne1 UTSW 10 5542024 start gained probably benign
R7099:Syne1 UTSW 10 5123744 missense probably benign 0.43
R7107:Syne1 UTSW 10 5132078 missense probably damaging 1.00
R7120:Syne1 UTSW 10 5293971 missense probably benign
R7127:Syne1 UTSW 10 5243180 missense probably damaging 1.00
R7128:Syne1 UTSW 10 5243180 missense probably damaging 1.00
R7131:Syne1 UTSW 10 5228221 missense probably damaging 1.00
R7132:Syne1 UTSW 10 5243180 missense probably damaging 1.00
R7133:Syne1 UTSW 10 5231592 missense probably damaging 1.00
R7135:Syne1 UTSW 10 5233409 missense probably benign 0.01
R7147:Syne1 UTSW 10 5249340 missense probably damaging 1.00
R7158:Syne1 UTSW 10 5057931 missense probably damaging 1.00
R7189:Syne1 UTSW 10 5424295 missense probably benign 0.03
R7193:Syne1 UTSW 10 5233406 missense probably damaging 1.00
R7194:Syne1 UTSW 10 5110859 missense probably damaging 1.00
R7233:Syne1 UTSW 10 5302160 missense probably damaging 1.00
R7255:Syne1 UTSW 10 5333446 missense probably damaging 0.98
R7267:Syne1 UTSW 10 5228218 missense probably damaging 1.00
R7294:Syne1 UTSW 10 5097483 critical splice donor site probably null
R7303:Syne1 UTSW 10 5256805 missense probably benign 0.04
R7313:Syne1 UTSW 10 5047635 missense probably damaging 1.00
R7330:Syne1 UTSW 10 5128434 missense probably benign 0.00
R7334:Syne1 UTSW 10 5057886 missense probably damaging 1.00
R7363:Syne1 UTSW 10 5140970 missense possibly damaging 0.45
R7400:Syne1 UTSW 10 5218580 missense probably benign 0.12
R7425:Syne1 UTSW 10 5425760 missense probably damaging 1.00
R7427:Syne1 UTSW 10 5273718 missense probably damaging 0.98
R7446:Syne1 UTSW 10 5222266 missense probably benign 0.00
R7462:Syne1 UTSW 10 5052793 missense possibly damaging 0.87
R7502:Syne1 UTSW 10 5333446 missense probably damaging 0.98
R7525:Syne1 UTSW 10 5185559 critical splice acceptor site probably null
R7529:Syne1 UTSW 10 5424382 missense probably damaging 1.00
R7577:Syne1 UTSW 10 5124820 missense probably damaging 1.00
R7579:Syne1 UTSW 10 5349324 missense probably damaging 1.00
R7594:Syne1 UTSW 10 5215190 critical splice donor site probably null
R7646:Syne1 UTSW 10 5172949 missense probably damaging 1.00
R7651:Syne1 UTSW 10 5205074 missense probably benign 0.38
R7651:Syne1 UTSW 10 5343416 missense probably damaging 1.00
R7669:Syne1 UTSW 10 5061531 missense probably damaging 1.00
R7672:Syne1 UTSW 10 5218527 missense probably benign 0.02
R7682:Syne1 UTSW 10 5162461 missense probably benign
R7702:Syne1 UTSW 10 5245835 missense probably damaging 1.00
X0017:Syne1 UTSW 10 5346917 missense probably damaging 1.00
X0025:Syne1 UTSW 10 5358973 nonsense probably null
X0063:Syne1 UTSW 10 5052354 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCCCCAGTACCTGCTGGTATAG -3'
(R):5'- AGGGAGAAGCGCCTTATCATTTGC -3'

Sequencing Primer
(F):5'- AGTACCTGCTGGTATAGTCCTTC -3'
(R):5'- CCATCTGAAAATCGCTGTGGAG -3'
Posted On2014-04-24