Mutagenetix > Incidental Mutations

Incidental Mutation 'R1642:Triobp'

173637

Institutional Source

Beutler Lab

Gene Symbol

Triobp

Ensembl Gene

ENSMUSG00000033088

Gene Name

TRIO and F-actin binding protein

Synonyms

EST478828, Mus EST 478828, Tara

MMRRC Submission

039678-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1642 (G1)

Quality Score

193

Status

Not validated

Chromosome

Chromosomal Location

78947724-79005869 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 79002148 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Serine at position 1830 (R1830S)

Ref Sequence

ENSEMBL: ENSMUSP00000105311 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000109687] [ENSMUST00000109688] [ENSMUST00000109689] [ENSMUST00000109690]

Predicted Effect

probably damaging
Transcript: ENSMUST00000109687
AA Change: R489S

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000105309
Gene: ENSMUSG00000033088
AA Change: R489S

Domain	Start	End	E-Value	Type
PH	7	104	6.2e-19	SMART
coiled coil region	277	304	N/A	INTRINSIC
coiled coil region	339	377	N/A	INTRINSIC
coiled coil region	401	463	N/A	INTRINSIC
coiled coil region	497	576	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000109688

SMART Domains

Protein: ENSMUSP00000105310
Gene: ENSMUSG00000033088

Domain	Start	End	E-Value	Type
low complexity region	6	21	N/A	INTRINSIC
low complexity region	30	47	N/A	INTRINSIC
PH	54	151	6.2e-19	SMART
coiled coil region	324	351	N/A	INTRINSIC
coiled coil region	386	424	N/A	INTRINSIC
coiled coil region	448	510	N/A	INTRINSIC
coiled coil region	544	623	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000109689
AA Change: R1830S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000105311
Gene: ENSMUSG00000033088
AA Change: R1830S

Domain	Start	End	E-Value	Type
low complexity region	130	154	N/A	INTRINSIC
low complexity region	291	311	N/A	INTRINSIC
internal_repeat_1	312	394	7.43e-13	PROSPERO
internal_repeat_1	390	540	7.43e-13	PROSPERO
low complexity region	585	600	N/A	INTRINSIC
low complexity region	638	657	N/A	INTRINSIC
low complexity region	697	729	N/A	INTRINSIC
low complexity region	767	777	N/A	INTRINSIC
low complexity region	885	901	N/A	INTRINSIC
low complexity region	903	923	N/A	INTRINSIC
low complexity region	995	1017	N/A	INTRINSIC
low complexity region	1054	1068	N/A	INTRINSIC
low complexity region	1221	1235	N/A	INTRINSIC
PH	1395	1492	6.2e-19	SMART
coiled coil region	1665	1692	N/A	INTRINSIC
coiled coil region	1727	1765	N/A	INTRINSIC
coiled coil region	1789	1851	N/A	INTRINSIC
coiled coil region	1885	1964	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000109690
AA Change: R1876S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000105312
Gene: ENSMUSG00000033088
AA Change: R1876S

Domain	Start	End	E-Value	Type
low complexity region	130	154	N/A	INTRINSIC
low complexity region	291	311	N/A	INTRINSIC
internal_repeat_1	312	394	9.24e-13	PROSPERO
internal_repeat_1	390	540	9.24e-13	PROSPERO
low complexity region	585	600	N/A	INTRINSIC
low complexity region	638	657	N/A	INTRINSIC
low complexity region	697	729	N/A	INTRINSIC
low complexity region	767	777	N/A	INTRINSIC
low complexity region	885	901	N/A	INTRINSIC
low complexity region	903	923	N/A	INTRINSIC
low complexity region	995	1017	N/A	INTRINSIC
low complexity region	1054	1068	N/A	INTRINSIC
low complexity region	1221	1235	N/A	INTRINSIC
PH	1441	1538	6.2e-19	SMART
coiled coil region	1711	1738	N/A	INTRINSIC
coiled coil region	1773	1811	N/A	INTRINSIC
coiled coil region	1835	1897	N/A	INTRINSIC
coiled coil region	1931	2010	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129922

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183598

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229535

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230425

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.4%
20x: 89.7%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a protein that interacts with trio, which is involved with neural tissue development and controlling actin cytoskeleton organization, cell motility, and cell growth. The encoded protein also associates with F-actin and stabilizes F-actin structures. Domains contained in this encoded protein are an N-terminal pleckstrin homology domain and a C-terminal coiled-coil region. Mutations in the human gene have been associated with a form of autosomal recessive nonsyndromic deafness. Multiple alternatively spliced transcript variants have been described [provided by RefSeq, Sep 2012]
PHENOTYPE: Mice homozygous for gene trapped alleles exhibit embryonic lethality. Mice homozygous for a targeted allele eliminating isoforms 4 and 5 exhibit profound deafness associated with stereocilia fragility and degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310057J18Rik	A	G	10: 28,986,237	V19A	probably benign	Het
3632451O06Rik	T	C	14: 49,768,410		probably null	Het
4931409K22Rik	C	A	5: 24,552,688	R177L	probably damaging	Het
6820408C15Rik	T	C	2: 152,440,854	Y210H	probably damaging	Het
Aars	T	A	8: 111,043,250	I327N	possibly damaging	Het
Abca6	T	A	11: 110,218,281	N688Y	possibly damaging	Het
Ablim3	T	C	18: 61,814,311	K457R	probably benign	Het
Acsm2	A	T	7: 119,563,637	N45Y	probably damaging	Het
Agxt2	T	C	15: 10,373,831	S108P	probably damaging	Het
Akr1cl	A	T	1: 65,021,429	M174K	probably benign	Het
Bfsp1	G	A	2: 143,841,763	R214W	probably damaging	Het
Cby3	A	G	11: 50,359,516	D183G	probably damaging	Het
Clip2	T	C	5: 134,503,253	D566G	possibly damaging	Het
Colgalt1	A	G	8: 71,620,757	I341V	probably benign	Het
Cyp2c38	T	A	19: 39,401,709	D349V	probably damaging	Het
Cyp3a16	T	A	5: 145,469,589	I18F	unknown	Het
Degs2	C	T	12: 108,692,192	C176Y	probably benign	Het
Dhx16	A	T	17: 35,891,065	T995S	probably damaging	Het
Dicer1	A	T	12: 104,713,156	C521S	probably damaging	Het
Dopey2	T	C	16: 93,762,315	S532P	probably benign	Het
Dpysl4	T	G	7: 139,090,338	M124R	probably damaging	Het
Eml6	A	G	11: 29,777,001		probably null	Het
Erbb4	A	T	1: 68,331,234	V395D	probably damaging	Het
Esf1	T	C	2: 140,158,486	D460G	possibly damaging	Het
F830045P16Rik	G	A	2: 129,463,714	H247Y	probably benign	Het
Fsbp	T	A	4: 11,583,965	S221R	probably benign	Het
Fstl5	T	A	3: 76,410,622	N198K	possibly damaging	Het
Gemin5	G	T	11: 58,139,080	H855Q	probably damaging	Het
Gjd3	T	C	11: 98,982,709	E103G	probably benign	Het
I0C0044D17Rik	A	G	4: 98,820,234		probably benign	Het
Itgb4	A	T	11: 116,007,357	R1646W	probably damaging	Het
Klri2	A	T	6: 129,738,874	C121S	probably benign	Het
Lamc3	A	G	2: 31,915,996	Y703C	probably damaging	Het
Lrrc10	A	G	10: 117,045,883	N154S	probably damaging	Het
Lrriq1	A	G	10: 103,214,456	F812L	probably benign	Het
Naip2	C	T	13: 100,161,981	A516T	possibly damaging	Het
Nav1	T	C	1: 135,452,272	Y1564C	probably damaging	Het
Ndufc1	T	C	3: 51,408,243	T25A	probably benign	Het
Neurl4	A	G	11: 69,903,659	M23V	probably benign	Het
Nnt	A	G	13: 119,404,550		probably null	Het
Nolc1	G	C	19: 46,079,022		probably null	Het
Nrg1	A	T	8: 31,824,508	M289K	probably benign	Het
Oas3	G	T	5: 120,777,574	H17Q	possibly damaging	Het
Olfr1030	A	G	2: 85,983,857	K6E	probably benign	Het
Olfr239	A	G	17: 33,199,456	Y132C	probably damaging	Het
Olfr30	A	G	11: 58,455,838	I37T	probably benign	Het
Olfr957	C	T	9: 39,511,354	R122H	possibly damaging	Het
Parp9	T	C	16: 35,967,697	Y612H	probably benign	Het
Pcdh1	A	T	18: 38,199,230	M240K	possibly damaging	Het
Pcdhb9	A	G	18: 37,400,934		probably benign	Het
Plpp2	A	G	10: 79,530,684	V42A	probably damaging	Het
Ppic	C	T	18: 53,407,062	V172M	probably damaging	Het
Ppp1r9b	A	G	11: 95,001,324		silent	Het
Prop1	A	G	11: 50,953,325	V27A	possibly damaging	Het
Psmc5	A	G	11: 106,262,416	T295A	probably benign	Het
Rpa1	A	G	11: 75,312,691		probably null	Het
Rrp12	A	G	19: 41,871,737	F1016L	probably damaging	Het
Scn2a	A	T	2: 65,683,697	I242F	probably damaging	Het
Slco1a6	T	A	6: 142,086,434	H655L	probably benign	Het
Sp140	G	A	1: 85,610,824		probably null	Het
Syne1	A	G	10: 5,348,694	I1071T	possibly damaging	Het
Tbc1d9b	A	G	11: 50,149,832	D392G	probably damaging	Het
Tcaim	G	A	9: 122,818,773		probably null	Het
Tgm3	T	A	2: 130,047,782	V632E	probably damaging	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Vps8	A	G	16: 21,581,579	T1266A	probably benign	Het
Znfx1	T	C	2: 167,039,010	I285V	possibly damaging	Het

Other mutations in Triobp

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01634:Triobp	APN	15	78993368	missense	probably damaging	1.00
IGL01904:Triobp	APN	15	78967364	missense	possibly damaging	0.80
IGL01957:Triobp	APN	15	78972647	critical splice donor site	probably null
IGL02085:Triobp	APN	15	78974297	splice site	probably benign
IGL02260:Triobp	APN	15	78966362	missense	probably benign	0.00
IGL02498:Triobp	APN	15	78961043	missense	probably benign	0.01
IGL02551:Triobp	APN	15	78973489	missense	probably benign
IGL02740:Triobp	APN	15	78966689	missense	probably benign	0.21
IGL02810:Triobp	APN	15	79002203	missense	possibly damaging	0.95
IGL03063:Triobp	APN	15	78990884	missense	probably damaging	1.00
FR4304:Triobp	UTSW	15	78993387	unclassified	probably benign
FR4340:Triobp	UTSW	15	78993390	unclassified	probably benign
FR4342:Triobp	UTSW	15	78993392	unclassified	probably benign
FR4449:Triobp	UTSW	15	78993389	unclassified	probably benign
FR4548:Triobp	UTSW	15	78993387	unclassified	probably benign
FR4548:Triobp	UTSW	15	78993390	unclassified	probably benign
R0276:Triobp	UTSW	15	78973676	missense	probably benign	0.09
R0309:Triobp	UTSW	15	78976540	missense	probably damaging	1.00
R0433:Triobp	UTSW	15	78968201	missense	possibly damaging	0.69
R0464:Triobp	UTSW	15	78966986	missense	possibly damaging	0.71
R0525:Triobp	UTSW	15	78973898	missense	possibly damaging	0.93
R0665:Triobp	UTSW	15	78973898	missense	possibly damaging	0.93
R0689:Triobp	UTSW	15	78959988	nonsense	probably null
R1149:Triobp	UTSW	15	78966479	missense	probably benign	0.00
R1149:Triobp	UTSW	15	78966479	missense	probably benign	0.00
R1151:Triobp	UTSW	15	78966479	missense	probably benign	0.00
R1152:Triobp	UTSW	15	78966479	missense	probably benign	0.00
R1510:Triobp	UTSW	15	79003767	missense	probably damaging	1.00
R1519:Triobp	UTSW	15	78973738	missense	probably benign	0.00
R1732:Triobp	UTSW	15	78967228	missense	possibly damaging	0.69
R1755:Triobp	UTSW	15	78966479	missense	probably benign	0.00
R1975:Triobp	UTSW	15	78966708	missense	probably benign
R2051:Triobp	UTSW	15	79004540	missense	probably damaging	1.00
R2073:Triobp	UTSW	15	78973895	missense	probably damaging	0.99
R2260:Triobp	UTSW	15	78991440	critical splice donor site	probably null
R2351:Triobp	UTSW	15	79004580	missense	probably benign	0.09
R2902:Triobp	UTSW	15	78973418	missense	possibly damaging	0.90
R3801:Triobp	UTSW	15	78973700	missense	probably benign	0.04
R3959:Triobp	UTSW	15	79002389	nonsense	probably null
R4003:Triobp	UTSW	15	78959977	unclassified	probably benign
R4084:Triobp	UTSW	15	78973671	missense	probably benign	0.19
R4482:Triobp	UTSW	15	78966563	missense	possibly damaging	0.87
R4592:Triobp	UTSW	15	78967095	missense	probably benign
R4662:Triobp	UTSW	15	78993269	missense	probably damaging	1.00
R4732:Triobp	UTSW	15	78967113	missense	probably damaging	0.99
R4733:Triobp	UTSW	15	78967113	missense	probably damaging	0.99
R4789:Triobp	UTSW	15	78991028	missense	probably damaging	1.00
R4968:Triobp	UTSW	15	78966616	missense	probably benign	0.03
R4990:Triobp	UTSW	15	78967005	missense	probably benign	0.00
R5129:Triobp	UTSW	15	78961096	missense	probably benign	0.15
R5181:Triobp	UTSW	15	78967754	missense	probably benign	0.00
R5279:Triobp	UTSW	15	78994391	missense	possibly damaging	0.66
R5584:Triobp	UTSW	15	78968132	missense	possibly damaging	0.89
R5601:Triobp	UTSW	15	78973633	missense	probably damaging	1.00
R5810:Triobp	UTSW	15	78968267	missense	probably benign	0.07
R5969:Triobp	UTSW	15	78967540	missense	probably benign	0.05
R6722:Triobp	UTSW	15	79001565	missense	probably damaging	1.00
R6739:Triobp	UTSW	15	78966366	missense	possibly damaging	0.77
R6810:Triobp	UTSW	15	78966615	missense	possibly damaging	0.47
R7011:Triobp	UTSW	15	78978723	missense	probably damaging	0.98
R7015:Triobp	UTSW	15	78994060	missense	probably damaging	0.99
R7200:Triobp	UTSW	15	78966842	small deletion	probably benign
R7294:Triobp	UTSW	15	78973976	missense	probably damaging	0.99
R7688:Triobp	UTSW	15	78961111	splice site	probably null
R7805:Triobp	UTSW	15	78974004	missense	probably benign	0.37
R7972:Triobp	UTSW	15	78967986	missense	probably damaging	1.00
R7977:Triobp	UTSW	15	79001544	missense	probably damaging	1.00
R7987:Triobp	UTSW	15	79001544	missense	probably damaging	1.00
R7999:Triobp	UTSW	15	78959944	missense	probably damaging	0.99
R8344:Triobp	UTSW	15	78958275	missense	possibly damaging	0.67
R8348:Triobp	UTSW	15	78994126	missense	possibly damaging	0.85
R8446:Triobp	UTSW	15	78994126	missense	possibly damaging	0.85
R8448:Triobp	UTSW	15	78994126	missense	possibly damaging	0.85
R8469:Triobp	UTSW	15	78967019	missense	probably benign	0.00
R8491:Triobp	UTSW	15	78994126	missense	possibly damaging	0.85
R8492:Triobp	UTSW	15	78994126	missense	possibly damaging	0.85
R8493:Triobp	UTSW	15	78994126	missense	possibly damaging	0.85
RF001:Triobp	UTSW	15	78967027	small insertion	probably benign
RF005:Triobp	UTSW	15	78967061	small insertion	probably benign
RF007:Triobp	UTSW	15	78967044	small insertion	probably benign
RF022:Triobp	UTSW	15	78974282	missense	probably benign	0.05
RF028:Triobp	UTSW	15	78967039	small insertion	probably benign
RF032:Triobp	UTSW	15	78967036	small insertion	probably benign
RF035:Triobp	UTSW	15	78967039	small insertion	probably benign
RF039:Triobp	UTSW	15	78967036	small insertion	probably benign
RF039:Triobp	UTSW	15	78967039	small insertion	probably benign
RF040:Triobp	UTSW	15	78967063	small insertion	probably benign
RF049:Triobp	UTSW	15	78967061	small insertion	probably benign
RF051:Triobp	UTSW	15	78967034	small insertion	probably benign
RF058:Triobp	UTSW	15	78967044	small insertion	probably benign
X0026:Triobp	UTSW	15	78960023	missense	possibly damaging	0.94
Z1177:Triobp	UTSW	15	79002181	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCACATGAGTCAACAGTGCCCAAG -3'
(R):5'- GCTCACAGGAACTCCTCTCATTGC -3'

Sequencing Primer
(F):5'- TCTTGACCGCTAGGAGAGTC -3'
(R):5'- CCTGCGAGGCGATGAAG -3'

Posted On

2014-04-24