Incidental Mutation 'R1642:Triobp'
ID173637
Institutional Source Beutler Lab
Gene Symbol Triobp
Ensembl Gene ENSMUSG00000033088
Gene NameTRIO and F-actin binding protein
SynonymsEST478828, Mus EST 478828, Tara
MMRRC Submission 039678-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1642 (G1)
Quality Score193
Status Not validated
Chromosome15
Chromosomal Location78947724-79005869 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 79002148 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 1830 (R1830S)
Ref Sequence ENSEMBL: ENSMUSP00000105311 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109687] [ENSMUST00000109688] [ENSMUST00000109689] [ENSMUST00000109690]
Predicted Effect probably damaging
Transcript: ENSMUST00000109687
AA Change: R489S

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105309
Gene: ENSMUSG00000033088
AA Change: R489S

DomainStartEndE-ValueType
PH 7 104 6.2e-19 SMART
coiled coil region 277 304 N/A INTRINSIC
coiled coil region 339 377 N/A INTRINSIC
coiled coil region 401 463 N/A INTRINSIC
coiled coil region 497 576 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000109688
SMART Domains Protein: ENSMUSP00000105310
Gene: ENSMUSG00000033088

DomainStartEndE-ValueType
low complexity region 6 21 N/A INTRINSIC
low complexity region 30 47 N/A INTRINSIC
PH 54 151 6.2e-19 SMART
coiled coil region 324 351 N/A INTRINSIC
coiled coil region 386 424 N/A INTRINSIC
coiled coil region 448 510 N/A INTRINSIC
coiled coil region 544 623 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109689
AA Change: R1830S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105311
Gene: ENSMUSG00000033088
AA Change: R1830S

DomainStartEndE-ValueType
low complexity region 130 154 N/A INTRINSIC
low complexity region 291 311 N/A INTRINSIC
internal_repeat_1 312 394 7.43e-13 PROSPERO
internal_repeat_1 390 540 7.43e-13 PROSPERO
low complexity region 585 600 N/A INTRINSIC
low complexity region 638 657 N/A INTRINSIC
low complexity region 697 729 N/A INTRINSIC
low complexity region 767 777 N/A INTRINSIC
low complexity region 885 901 N/A INTRINSIC
low complexity region 903 923 N/A INTRINSIC
low complexity region 995 1017 N/A INTRINSIC
low complexity region 1054 1068 N/A INTRINSIC
low complexity region 1221 1235 N/A INTRINSIC
PH 1395 1492 6.2e-19 SMART
coiled coil region 1665 1692 N/A INTRINSIC
coiled coil region 1727 1765 N/A INTRINSIC
coiled coil region 1789 1851 N/A INTRINSIC
coiled coil region 1885 1964 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109690
AA Change: R1876S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000105312
Gene: ENSMUSG00000033088
AA Change: R1876S

DomainStartEndE-ValueType
low complexity region 130 154 N/A INTRINSIC
low complexity region 291 311 N/A INTRINSIC
internal_repeat_1 312 394 9.24e-13 PROSPERO
internal_repeat_1 390 540 9.24e-13 PROSPERO
low complexity region 585 600 N/A INTRINSIC
low complexity region 638 657 N/A INTRINSIC
low complexity region 697 729 N/A INTRINSIC
low complexity region 767 777 N/A INTRINSIC
low complexity region 885 901 N/A INTRINSIC
low complexity region 903 923 N/A INTRINSIC
low complexity region 995 1017 N/A INTRINSIC
low complexity region 1054 1068 N/A INTRINSIC
low complexity region 1221 1235 N/A INTRINSIC
PH 1441 1538 6.2e-19 SMART
coiled coil region 1711 1738 N/A INTRINSIC
coiled coil region 1773 1811 N/A INTRINSIC
coiled coil region 1835 1897 N/A INTRINSIC
coiled coil region 1931 2010 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129922
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183598
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229535
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230425
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.4%
  • 20x: 89.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein that interacts with trio, which is involved with neural tissue development and controlling actin cytoskeleton organization, cell motility, and cell growth. The encoded protein also associates with F-actin and stabilizes F-actin structures. Domains contained in this encoded protein are an N-terminal pleckstrin homology domain and a C-terminal coiled-coil region. Mutations in the human gene have been associated with a form of autosomal recessive nonsyndromic deafness. Multiple alternatively spliced transcript variants have been described [provided by RefSeq, Sep 2012]
PHENOTYPE: Mice homozygous for gene trapped alleles exhibit embryonic lethality. Mice homozygous for a targeted allele eliminating isoforms 4 and 5 exhibit profound deafness associated with stereocilia fragility and degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057J18Rik A G 10: 28,986,237 V19A probably benign Het
3632451O06Rik T C 14: 49,768,410 probably null Het
4931409K22Rik C A 5: 24,552,688 R177L probably damaging Het
6820408C15Rik T C 2: 152,440,854 Y210H probably damaging Het
Aars T A 8: 111,043,250 I327N possibly damaging Het
Abca6 T A 11: 110,218,281 N688Y possibly damaging Het
Ablim3 T C 18: 61,814,311 K457R probably benign Het
Acsm2 A T 7: 119,563,637 N45Y probably damaging Het
Agxt2 T C 15: 10,373,831 S108P probably damaging Het
Akr1cl A T 1: 65,021,429 M174K probably benign Het
Bfsp1 G A 2: 143,841,763 R214W probably damaging Het
Cby3 A G 11: 50,359,516 D183G probably damaging Het
Clip2 T C 5: 134,503,253 D566G possibly damaging Het
Colgalt1 A G 8: 71,620,757 I341V probably benign Het
Cyp2c38 T A 19: 39,401,709 D349V probably damaging Het
Cyp3a16 T A 5: 145,469,589 I18F unknown Het
Degs2 C T 12: 108,692,192 C176Y probably benign Het
Dhx16 A T 17: 35,891,065 T995S probably damaging Het
Dicer1 A T 12: 104,713,156 C521S probably damaging Het
Dopey2 T C 16: 93,762,315 S532P probably benign Het
Dpysl4 T G 7: 139,090,338 M124R probably damaging Het
Eml6 A G 11: 29,777,001 probably null Het
Erbb4 A T 1: 68,331,234 V395D probably damaging Het
Esf1 T C 2: 140,158,486 D460G possibly damaging Het
F830045P16Rik G A 2: 129,463,714 H247Y probably benign Het
Fsbp T A 4: 11,583,965 S221R probably benign Het
Fstl5 T A 3: 76,410,622 N198K possibly damaging Het
Gemin5 G T 11: 58,139,080 H855Q probably damaging Het
Gjd3 T C 11: 98,982,709 E103G probably benign Het
I0C0044D17Rik A G 4: 98,820,234 probably benign Het
Itgb4 A T 11: 116,007,357 R1646W probably damaging Het
Klri2 A T 6: 129,738,874 C121S probably benign Het
Lamc3 A G 2: 31,915,996 Y703C probably damaging Het
Lrrc10 A G 10: 117,045,883 N154S probably damaging Het
Lrriq1 A G 10: 103,214,456 F812L probably benign Het
Naip2 C T 13: 100,161,981 A516T possibly damaging Het
Nav1 T C 1: 135,452,272 Y1564C probably damaging Het
Ndufc1 T C 3: 51,408,243 T25A probably benign Het
Neurl4 A G 11: 69,903,659 M23V probably benign Het
Nnt A G 13: 119,404,550 probably null Het
Nolc1 G C 19: 46,079,022 probably null Het
Nrg1 A T 8: 31,824,508 M289K probably benign Het
Oas3 G T 5: 120,777,574 H17Q possibly damaging Het
Olfr1030 A G 2: 85,983,857 K6E probably benign Het
Olfr239 A G 17: 33,199,456 Y132C probably damaging Het
Olfr30 A G 11: 58,455,838 I37T probably benign Het
Olfr957 C T 9: 39,511,354 R122H possibly damaging Het
Parp9 T C 16: 35,967,697 Y612H probably benign Het
Pcdh1 A T 18: 38,199,230 M240K possibly damaging Het
Pcdhb9 A G 18: 37,400,934 probably benign Het
Plpp2 A G 10: 79,530,684 V42A probably damaging Het
Ppic C T 18: 53,407,062 V172M probably damaging Het
Ppp1r9b A G 11: 95,001,324 silent Het
Prop1 A G 11: 50,953,325 V27A possibly damaging Het
Psmc5 A G 11: 106,262,416 T295A probably benign Het
Rpa1 A G 11: 75,312,691 probably null Het
Rrp12 A G 19: 41,871,737 F1016L probably damaging Het
Scn2a A T 2: 65,683,697 I242F probably damaging Het
Slco1a6 T A 6: 142,086,434 H655L probably benign Het
Sp140 G A 1: 85,610,824 probably null Het
Syne1 A G 10: 5,348,694 I1071T possibly damaging Het
Tbc1d9b A G 11: 50,149,832 D392G probably damaging Het
Tcaim G A 9: 122,818,773 probably null Het
Tgm3 T A 2: 130,047,782 V632E probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Vps8 A G 16: 21,581,579 T1266A probably benign Het
Znfx1 T C 2: 167,039,010 I285V possibly damaging Het
Other mutations in Triobp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01634:Triobp APN 15 78993368 missense probably damaging 1.00
IGL01904:Triobp APN 15 78967364 missense possibly damaging 0.80
IGL01957:Triobp APN 15 78972647 critical splice donor site probably null
IGL02085:Triobp APN 15 78974297 splice site probably benign
IGL02260:Triobp APN 15 78966362 missense probably benign 0.00
IGL02498:Triobp APN 15 78961043 missense probably benign 0.01
IGL02551:Triobp APN 15 78973489 missense probably benign
IGL02740:Triobp APN 15 78966689 missense probably benign 0.21
IGL02810:Triobp APN 15 79002203 missense possibly damaging 0.95
IGL03063:Triobp APN 15 78990884 missense probably damaging 1.00
FR4304:Triobp UTSW 15 78993387 unclassified probably benign
FR4340:Triobp UTSW 15 78993390 unclassified probably benign
FR4342:Triobp UTSW 15 78993392 unclassified probably benign
FR4449:Triobp UTSW 15 78993389 unclassified probably benign
FR4548:Triobp UTSW 15 78993387 unclassified probably benign
FR4548:Triobp UTSW 15 78993390 unclassified probably benign
R0276:Triobp UTSW 15 78973676 missense probably benign 0.09
R0309:Triobp UTSW 15 78976540 missense probably damaging 1.00
R0433:Triobp UTSW 15 78968201 missense possibly damaging 0.69
R0464:Triobp UTSW 15 78966986 missense possibly damaging 0.71
R0525:Triobp UTSW 15 78973898 missense possibly damaging 0.93
R0665:Triobp UTSW 15 78973898 missense possibly damaging 0.93
R0689:Triobp UTSW 15 78959988 nonsense probably null
R1149:Triobp UTSW 15 78966479 missense probably benign 0.00
R1149:Triobp UTSW 15 78966479 missense probably benign 0.00
R1151:Triobp UTSW 15 78966479 missense probably benign 0.00
R1152:Triobp UTSW 15 78966479 missense probably benign 0.00
R1510:Triobp UTSW 15 79003767 missense probably damaging 1.00
R1519:Triobp UTSW 15 78973738 missense probably benign 0.00
R1732:Triobp UTSW 15 78967228 missense possibly damaging 0.69
R1755:Triobp UTSW 15 78966479 missense probably benign 0.00
R1975:Triobp UTSW 15 78966708 missense probably benign
R2051:Triobp UTSW 15 79004540 missense probably damaging 1.00
R2073:Triobp UTSW 15 78973895 missense probably damaging 0.99
R2260:Triobp UTSW 15 78991440 critical splice donor site probably null
R2351:Triobp UTSW 15 79004580 missense probably benign 0.09
R2902:Triobp UTSW 15 78973418 missense possibly damaging 0.90
R3801:Triobp UTSW 15 78973700 missense probably benign 0.04
R3959:Triobp UTSW 15 79002389 nonsense probably null
R4003:Triobp UTSW 15 78959977 unclassified probably benign
R4084:Triobp UTSW 15 78973671 missense probably benign 0.19
R4482:Triobp UTSW 15 78966563 missense possibly damaging 0.87
R4592:Triobp UTSW 15 78967095 missense probably benign
R4662:Triobp UTSW 15 78993269 missense probably damaging 1.00
R4732:Triobp UTSW 15 78967113 missense probably damaging 0.99
R4733:Triobp UTSW 15 78967113 missense probably damaging 0.99
R4789:Triobp UTSW 15 78991028 missense probably damaging 1.00
R4968:Triobp UTSW 15 78966616 missense probably benign 0.03
R4990:Triobp UTSW 15 78967005 missense probably benign 0.00
R5129:Triobp UTSW 15 78961096 missense probably benign 0.15
R5181:Triobp UTSW 15 78967754 missense probably benign 0.00
R5279:Triobp UTSW 15 78994391 missense possibly damaging 0.66
R5584:Triobp UTSW 15 78968132 missense possibly damaging 0.89
R5601:Triobp UTSW 15 78973633 missense probably damaging 1.00
R5810:Triobp UTSW 15 78968267 missense probably benign 0.07
R5969:Triobp UTSW 15 78967540 missense probably benign 0.05
R6722:Triobp UTSW 15 79001565 missense probably damaging 1.00
R6739:Triobp UTSW 15 78966366 missense possibly damaging 0.77
R6810:Triobp UTSW 15 78966615 missense possibly damaging 0.47
R7011:Triobp UTSW 15 78978723 missense probably damaging 0.98
R7015:Triobp UTSW 15 78994060 missense probably damaging 0.99
R7200:Triobp UTSW 15 78966842 small deletion probably benign
R7294:Triobp UTSW 15 78973976 missense probably damaging 0.99
X0026:Triobp UTSW 15 78960023 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TCACATGAGTCAACAGTGCCCAAG -3'
(R):5'- GCTCACAGGAACTCCTCTCATTGC -3'

Sequencing Primer
(F):5'- TCTTGACCGCTAGGAGAGTC -3'
(R):5'- CCTGCGAGGCGATGAAG -3'
Posted On2014-04-24