Incidental Mutation 'R1643:Clic4'
ID173663
Institutional Source Beutler Lab
Gene Symbol Clic4
Ensembl Gene ENSMUSG00000037242
Gene Namechloride intracellular channel 4 (mitochondrial)
SynonymsD0Jmb3, mc3s5, mtCLIC
MMRRC Submission 039679-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1643 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location135213969-135272814 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 135238895 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 50 (V50A)
Ref Sequence ENSEMBL: ENSMUSP00000041453 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037099]
Predicted Effect possibly damaging
Transcript: ENSMUST00000037099
AA Change: V50A

PolyPhen 2 Score 0.686 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000041453
Gene: ENSMUSG00000037242
AA Change: V50A

DomainStartEndE-ValueType
Pfam:GST_N_3 31 103 7.3e-9 PFAM
Pfam:GST_C_2 134 223 2.7e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143370
Meta Mutation Damage Score 0.2883 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.5%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Chloride channels are a diverse group of proteins that regulate fundamental cellular processes including stabilization of cell membrane potential, transepithelial transport, maintenance of intracellular pH, and regulation of cell volume. Chloride intracellular channel 4 (CLIC4) protein, encoded by the CLIC4 gene, is a member of the p64 family; the gene is expressed in many tissues and exhibits a intracellular vesicular pattern in Panc-1 cells (pancreatic cancer cells). [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for null mutations may display decreased survival, body weight and female fertility, impaired angiogenesis, increased suscpetibility to Listeria infection, increased resistance to LPS treatment, skin erosions and/or delayed wound healing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700037C18Rik T A 16: 3,907,078 K45* probably null Het
Abcc1 T A 16: 14,413,368 Y457N probably damaging Het
Actr3b A G 5: 25,812,011 D19G probably damaging Het
Adam39 T C 8: 40,826,486 V638A possibly damaging Het
Adamts1 G T 16: 85,796,817 probably benign Het
AI661453 A G 17: 47,467,866 probably benign Het
Ank3 G A 10: 69,884,802 S565N probably benign Het
Casd1 A G 6: 4,621,243 E267G probably benign Het
Casr T C 16: 36,500,205 K527R probably damaging Het
Cep128 A C 12: 91,325,532 S248A probably damaging Het
Cylc2 C T 4: 51,225,173 A36V probably benign Het
Derl1 T A 15: 57,878,559 M127L probably benign Het
Dnah6 A G 6: 73,044,752 V3529A possibly damaging Het
Dock1 G T 7: 135,098,779 L1089F probably damaging Het
Edil3 T A 13: 89,289,576 probably null Het
Ephb1 A G 9: 101,996,825 V550A probably damaging Het
Fam129c A G 8: 71,600,164 D94G probably benign Het
Fcho2 G A 13: 98,784,816 T187I probably benign Het
Gas6 T C 8: 13,465,902 probably null Het
Gdf7 T C 12: 8,297,971 Y442C probably damaging Het
Gm11567 G A 11: 99,879,797 G187E unknown Het
Gm11639 A T 11: 104,698,978 T134S probably benign Het
Gm8674 T C 13: 49,901,358 noncoding transcript Het
Ift80 T A 3: 68,916,157 I591F probably benign Het
Kcnn3 C T 3: 89,520,497 S10L unknown Het
Keg1 A G 19: 12,719,042 I197V probably benign Het
Klhdc9 A G 1: 171,359,466 probably null Het
Klhl11 A G 11: 100,463,015 V660A probably benign Het
Lamc1 T C 1: 153,258,072 probably benign Het
Lrrc73 G T 17: 46,255,340 probably null Het
Lrriq1 G A 10: 103,214,824 S689L probably benign Het
Magi2 A G 5: 20,705,506 probably benign Het
Meis1 A G 11: 19,016,278 S32P probably benign Het
Mia2 A G 12: 59,179,845 probably null Het
Mlph T C 1: 90,941,734 L486P probably damaging Het
Myh10 A G 11: 68,792,010 E1090G probably damaging Het
Mylk T C 16: 34,875,635 S247P probably benign Het
Naip2 C T 13: 100,161,981 A516T possibly damaging Het
Ndufc1 T C 3: 51,408,243 T25A probably benign Het
Nedd4l A G 18: 65,198,641 Y636C probably damaging Het
Nfib A T 4: 82,498,679 Y40N probably damaging Het
Nisch T C 14: 31,173,168 D1057G probably damaging Het
P3h2 T C 16: 25,972,291 H475R probably benign Het
Pde6c C A 19: 38,161,958 T517K possibly damaging Het
Piezo2 T C 18: 63,082,915 I994V probably benign Het
Pik3r4 A G 9: 105,687,152 D1315G possibly damaging Het
Pip5k1c T G 10: 81,314,994 V46G probably damaging Het
Pole A G 5: 110,317,845 E1213G probably damaging Het
Prl7d1 T C 13: 27,712,131 S88G possibly damaging Het
Prodh T A 16: 18,081,069 N72I probably benign Het
Prrc2a G A 17: 35,156,954 R907C probably damaging Het
Ptger2 T A 14: 44,988,966 M1K probably null Het
Samd4b G C 7: 28,423,616 Q6E probably damaging Het
Sec24a C T 11: 51,704,385 R916H probably benign Het
Slc12a5 C A 2: 164,994,027 D865E probably benign Het
Slc17a3 T C 13: 23,857,198 probably benign Het
Ssrp1 T C 2: 85,041,185 V317A possibly damaging Het
Stim1 A G 7: 102,386,100 D95G possibly damaging Het
Taok2 A T 7: 126,875,938 probably benign Het
Tcof1 T G 18: 60,816,228 K1205T possibly damaging Het
Trim43c C T 9: 88,847,477 R325C probably damaging Het
Trub2 T G 2: 29,777,936 T231P probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Uty T A Y: 1,152,054 D724V probably damaging Het
Vmn2r98 A G 17: 19,080,908 D724G probably damaging Het
Wdfy3 A G 5: 101,875,915 I2442T possibly damaging Het
Wdfy4 T C 14: 33,073,585 probably null Het
Zfp280b A G 10: 76,039,610 H441R probably damaging Het
Zfp60 A T 7: 27,736,975 Q7L probably damaging Het
Zzef1 T C 11: 72,826,202 L406S probably damaging Het
Other mutations in Clic4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01564:Clic4 APN 4 135217193 missense probably damaging 0.99
IGL01674:Clic4 APN 4 135238893 missense probably benign 0.01
IGL03343:Clic4 APN 4 135218578 missense possibly damaging 0.91
IGL03372:Clic4 APN 4 135218614 missense probably damaging 0.99
R2201:Clic4 UTSW 4 135223539 missense probably damaging 1.00
R4181:Clic4 UTSW 4 135226039 missense probably benign 0.00
R4302:Clic4 UTSW 4 135226039 missense probably benign 0.00
R4335:Clic4 UTSW 4 135218605 missense probably benign 0.15
R4600:Clic4 UTSW 4 135238989 intron probably null
R4939:Clic4 UTSW 4 135223541 missense probably benign 0.16
R5359:Clic4 UTSW 4 135217135 missense probably benign 0.00
R5437:Clic4 UTSW 4 135217246 missense probably damaging 1.00
R5902:Clic4 UTSW 4 135272558 missense probably benign
R7670:Clic4 UTSW 4 135217205 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAGGGAGATTCACCCACATGCAG -3'
(R):5'- TGGTTGGAATTCATCGGCAGCTC -3'

Sequencing Primer
(F):5'- CTCGGGGTGACACTGTAAATC -3'
(R):5'- CAGCTCTGCTGCTTGCG -3'
Posted On2014-04-24