Incidental Mutation 'R1643:Zfp60'
ID 173670
Institutional Source Beutler Lab
Gene Symbol Zfp60
Ensembl Gene ENSMUSG00000037640
Gene Name zinc finger protein 60
Synonyms Mfg-3, Mfg3, 6330516O17Rik
MMRRC Submission 039679-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1643 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 27430834-27451114 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 27436400 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Leucine at position 7 (Q7L)
Ref Sequence ENSEMBL: ENSMUSP00000118469 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042641] [ENSMUST00000108336] [ENSMUST00000130997] [ENSMUST00000136373] [ENSMUST00000167955]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000042641
AA Change: Q7L

PolyPhen 2 Score 0.535 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000036627
Gene: ENSMUSG00000037640
AA Change: Q7L

DomainStartEndE-ValueType
KRAB 14 75 8.48e-36 SMART
ZnF_C2H2 173 195 2.67e-1 SMART
ZnF_C2H2 201 223 2.09e-3 SMART
ZnF_C2H2 229 251 1.18e-2 SMART
ZnF_C2H2 257 279 2.24e-3 SMART
ZnF_C2H2 285 307 2.65e-5 SMART
ZnF_C2H2 313 335 5.5e-3 SMART
ZnF_C2H2 341 363 3.89e-3 SMART
ZnF_C2H2 369 391 6.32e-3 SMART
ZnF_C2H2 397 419 5.14e-3 SMART
ZnF_C2H2 425 447 7.9e-4 SMART
ZnF_C2H2 453 475 1.67e-2 SMART
ZnF_C2H2 481 503 4.4e-2 SMART
ZnF_C2H2 509 531 4.24e-4 SMART
ZnF_C2H2 537 559 5.21e-4 SMART
ZnF_C2H2 565 587 5.14e-3 SMART
ZnF_C2H2 593 615 3.89e-3 SMART
ZnF_C2H2 621 643 1.95e-3 SMART
ZnF_C2H2 649 671 6.67e-2 SMART
ZnF_C2H2 677 699 8.34e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000108336
AA Change: Q7L

PolyPhen 2 Score 0.535 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000103973
Gene: ENSMUSG00000037640
AA Change: Q7L

DomainStartEndE-ValueType
KRAB 14 75 8.48e-36 SMART
ZnF_C2H2 173 195 2.67e-1 SMART
ZnF_C2H2 201 223 2.09e-3 SMART
ZnF_C2H2 229 251 1.18e-2 SMART
ZnF_C2H2 257 279 2.24e-3 SMART
ZnF_C2H2 285 307 2.65e-5 SMART
ZnF_C2H2 313 335 5.5e-3 SMART
ZnF_C2H2 341 363 3.89e-3 SMART
ZnF_C2H2 369 391 6.32e-3 SMART
ZnF_C2H2 397 419 5.14e-3 SMART
ZnF_C2H2 425 447 7.9e-4 SMART
ZnF_C2H2 453 475 1.67e-2 SMART
ZnF_C2H2 481 503 4.4e-2 SMART
ZnF_C2H2 509 531 4.24e-4 SMART
ZnF_C2H2 537 559 5.21e-4 SMART
ZnF_C2H2 565 587 5.14e-3 SMART
ZnF_C2H2 593 615 3.89e-3 SMART
ZnF_C2H2 621 643 1.95e-3 SMART
ZnF_C2H2 649 671 6.67e-2 SMART
ZnF_C2H2 677 699 8.34e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125228
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126884
Predicted Effect probably damaging
Transcript: ENSMUST00000130997
AA Change: Q7L

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000118469
Gene: ENSMUSG00000037640
AA Change: Q7L

DomainStartEndE-ValueType
KRAB 14 75 8.48e-36 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000136373
AA Change: Q7L

PolyPhen 2 Score 0.532 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000117049
Gene: ENSMUSG00000037640
AA Change: Q7L

DomainStartEndE-ValueType
KRAB 14 55 3.2e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141753
Predicted Effect possibly damaging
Transcript: ENSMUST00000167955
AA Change: Q7L

PolyPhen 2 Score 0.535 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000132607
Gene: ENSMUSG00000037640
AA Change: Q7L

DomainStartEndE-ValueType
KRAB 14 75 8.48e-36 SMART
ZnF_C2H2 173 195 2.67e-1 SMART
ZnF_C2H2 201 223 2.09e-3 SMART
ZnF_C2H2 229 251 1.18e-2 SMART
ZnF_C2H2 257 279 2.24e-3 SMART
ZnF_C2H2 285 307 2.65e-5 SMART
ZnF_C2H2 313 335 5.5e-3 SMART
ZnF_C2H2 341 363 3.89e-3 SMART
ZnF_C2H2 369 391 6.32e-3 SMART
ZnF_C2H2 397 419 5.14e-3 SMART
ZnF_C2H2 425 447 7.9e-4 SMART
ZnF_C2H2 453 475 1.67e-2 SMART
ZnF_C2H2 481 503 4.4e-2 SMART
ZnF_C2H2 509 531 4.24e-4 SMART
ZnF_C2H2 537 559 5.21e-4 SMART
ZnF_C2H2 565 587 5.14e-3 SMART
ZnF_C2H2 593 615 3.89e-3 SMART
ZnF_C2H2 621 643 1.95e-3 SMART
ZnF_C2H2 649 671 6.67e-2 SMART
ZnF_C2H2 677 699 8.34e-3 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.5%
Validation Efficiency 99% (74/75)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700037C18Rik T A 16: 3,724,942 (GRCm39) K45* probably null Het
Abcc1 T A 16: 14,231,232 (GRCm39) Y457N probably damaging Het
Actr3b A G 5: 26,017,009 (GRCm39) D19G probably damaging Het
Adam39 T C 8: 41,279,523 (GRCm39) V638A possibly damaging Het
Adamts1 G T 16: 85,593,705 (GRCm39) probably benign Het
AI661453 A G 17: 47,778,791 (GRCm39) probably benign Het
Ank3 G A 10: 69,720,632 (GRCm39) S565N probably benign Het
Casd1 A G 6: 4,621,243 (GRCm39) E267G probably benign Het
Casr T C 16: 36,320,567 (GRCm39) K527R probably damaging Het
Cep128 A C 12: 91,292,306 (GRCm39) S248A probably damaging Het
Clic4 A G 4: 134,966,206 (GRCm39) V50A possibly damaging Het
Cylc2 C T 4: 51,225,173 (GRCm39) A36V probably benign Het
Derl1 T A 15: 57,741,955 (GRCm39) M127L probably benign Het
Dnah6 A G 6: 73,021,735 (GRCm39) V3529A possibly damaging Het
Dock1 G T 7: 134,700,508 (GRCm39) L1089F probably damaging Het
Edil3 T A 13: 89,437,695 (GRCm39) probably null Het
Efcab3 A T 11: 104,589,804 (GRCm39) T134S probably benign Het
Ephb1 A G 9: 101,874,024 (GRCm39) V550A probably damaging Het
Fcho2 G A 13: 98,921,324 (GRCm39) T187I probably benign Het
Gas6 T C 8: 13,515,902 (GRCm39) probably null Het
Gdf7 T C 12: 8,347,971 (GRCm39) Y442C probably damaging Het
Gm11567 G A 11: 99,770,623 (GRCm39) G187E unknown Het
Gm8674 T C 13: 50,055,394 (GRCm39) noncoding transcript Het
Ift80 T A 3: 68,823,490 (GRCm39) I591F probably benign Het
Kcnn3 C T 3: 89,427,804 (GRCm39) S10L unknown Het
Keg1 A G 19: 12,696,406 (GRCm39) I197V probably benign Het
Klhdc9 A G 1: 171,187,034 (GRCm39) probably null Het
Klhl11 A G 11: 100,353,841 (GRCm39) V660A probably benign Het
Lamc1 T C 1: 153,133,818 (GRCm39) probably benign Het
Lrrc73 G T 17: 46,566,266 (GRCm39) probably null Het
Lrriq1 G A 10: 103,050,685 (GRCm39) S689L probably benign Het
Magi2 A G 5: 20,910,504 (GRCm39) probably benign Het
Meis1 A G 11: 18,966,278 (GRCm39) S32P probably benign Het
Mia2 A G 12: 59,226,631 (GRCm39) probably null Het
Mlph T C 1: 90,869,456 (GRCm39) L486P probably damaging Het
Myh10 A G 11: 68,682,836 (GRCm39) E1090G probably damaging Het
Mylk T C 16: 34,696,005 (GRCm39) S247P probably benign Het
Naip2 C T 13: 100,298,489 (GRCm39) A516T possibly damaging Het
Ndufc1 T C 3: 51,315,664 (GRCm39) T25A probably benign Het
Nedd4l A G 18: 65,331,712 (GRCm39) Y636C probably damaging Het
Nfib A T 4: 82,416,916 (GRCm39) Y40N probably damaging Het
Niban3 A G 8: 72,052,808 (GRCm39) D94G probably benign Het
Nisch T C 14: 30,895,125 (GRCm39) D1057G probably damaging Het
P3h2 T C 16: 25,791,041 (GRCm39) H475R probably benign Het
Pde6c C A 19: 38,150,406 (GRCm39) T517K possibly damaging Het
Piezo2 T C 18: 63,215,986 (GRCm39) I994V probably benign Het
Pik3r4 A G 9: 105,564,351 (GRCm39) D1315G possibly damaging Het
Pip5k1c T G 10: 81,150,828 (GRCm39) V46G probably damaging Het
Pole A G 5: 110,465,711 (GRCm39) E1213G probably damaging Het
Prl7d1 T C 13: 27,896,114 (GRCm39) S88G possibly damaging Het
Prodh T A 16: 17,898,933 (GRCm39) N72I probably benign Het
Prrc2a G A 17: 35,375,930 (GRCm39) R907C probably damaging Het
Ptger2 T A 14: 45,226,423 (GRCm39) M1K probably null Het
Samd4b G C 7: 28,123,041 (GRCm39) Q6E probably damaging Het
Sec24a C T 11: 51,595,212 (GRCm39) R916H probably benign Het
Slc12a5 C A 2: 164,835,947 (GRCm39) D865E probably benign Het
Slc17a3 T C 13: 24,041,181 (GRCm39) probably benign Het
Ssrp1 T C 2: 84,871,529 (GRCm39) V317A possibly damaging Het
Stim1 A G 7: 102,035,307 (GRCm39) D95G possibly damaging Het
Taok2 A T 7: 126,475,110 (GRCm39) probably benign Het
Tcof1 T G 18: 60,949,300 (GRCm39) K1205T possibly damaging Het
Trim43c C T 9: 88,729,530 (GRCm39) R325C probably damaging Het
Trub2 T G 2: 29,667,948 (GRCm39) T231P probably damaging Het
Ttn A T 2: 76,641,587 (GRCm39) L5176Q possibly damaging Het
Uty T A Y: 1,152,054 (GRCm39) D724V probably damaging Het
Vmn2r98 A G 17: 19,301,170 (GRCm39) D724G probably damaging Het
Wdfy3 A G 5: 102,023,781 (GRCm39) I2442T possibly damaging Het
Wdfy4 T C 14: 32,795,542 (GRCm39) probably null Het
Zfp280b A G 10: 75,875,444 (GRCm39) H441R probably damaging Het
Zzef1 T C 11: 72,717,028 (GRCm39) L406S probably damaging Het
Other mutations in Zfp60
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03353:Zfp60 APN 7 27,447,759 (GRCm39) nonsense probably null
PIT4494001:Zfp60 UTSW 7 27,448,126 (GRCm39) missense probably damaging 1.00
R1281:Zfp60 UTSW 7 27,437,852 (GRCm39) missense probably damaging 1.00
R1883:Zfp60 UTSW 7 27,449,435 (GRCm39) missense probably benign 0.00
R1930:Zfp60 UTSW 7 27,436,382 (GRCm39) start codon destroyed probably null 1.00
R3623:Zfp60 UTSW 7 27,448,753 (GRCm39) missense probably benign 0.01
R3624:Zfp60 UTSW 7 27,448,753 (GRCm39) missense probably benign 0.01
R3875:Zfp60 UTSW 7 27,449,006 (GRCm39) missense probably damaging 1.00
R5296:Zfp60 UTSW 7 27,437,955 (GRCm39) intron probably benign
R5491:Zfp60 UTSW 7 27,447,940 (GRCm39) splice site probably null
R5724:Zfp60 UTSW 7 27,447,758 (GRCm39) missense probably benign
R6134:Zfp60 UTSW 7 27,449,323 (GRCm39) missense probably benign 0.01
R6312:Zfp60 UTSW 7 27,448,201 (GRCm39) missense probably damaging 0.99
R6477:Zfp60 UTSW 7 27,449,228 (GRCm39) missense probably benign 0.00
R6649:Zfp60 UTSW 7 27,448,151 (GRCm39) missense probably benign 0.00
R6653:Zfp60 UTSW 7 27,448,151 (GRCm39) missense probably benign 0.00
R7041:Zfp60 UTSW 7 27,448,451 (GRCm39) missense probably benign 0.05
R7166:Zfp60 UTSW 7 27,448,937 (GRCm39) missense possibly damaging 0.82
R7185:Zfp60 UTSW 7 27,437,830 (GRCm39) missense probably damaging 1.00
R7334:Zfp60 UTSW 7 27,448,444 (GRCm39) missense probably damaging 1.00
R7560:Zfp60 UTSW 7 27,448,696 (GRCm39) missense probably damaging 1.00
R7560:Zfp60 UTSW 7 27,448,561 (GRCm39) missense probably damaging 0.99
R7561:Zfp60 UTSW 7 27,447,955 (GRCm39) missense probably damaging 1.00
R7673:Zfp60 UTSW 7 27,447,740 (GRCm39) missense probably benign 0.00
R7961:Zfp60 UTSW 7 27,447,881 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCAGCCCTGAGTTTACACAGGAGG -3'
(R):5'- TCAAAGTCAACCGCAGTGCCAG -3'

Sequencing Primer
(F):5'- TCCAGTGTGAAGATCTGAGC -3'
(R):5'- GCTGGGAAGAGGCACAGAC -3'
Posted On 2014-04-24