Mutagenetix > Incidental Mutation

Incidental Mutation 'R1643:Stim1'

173672

Institutional Source

Beutler Lab

Gene Symbol

Stim1

Ensembl Gene

ENSMUSG00000030987

Gene Name

stromal interaction molecule 1

Synonyms

SIM

MMRRC Submission

039679-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1643 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

102267806-102437319 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 102386100 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 95 (D95G)

Ref Sequence

ENSEMBL: ENSMUSP00000147443 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033289] [ENSMUST00000209255] [ENSMUST00000211457]

AlphaFold

P70302

Predicted Effect

possibly damaging
Transcript: ENSMUST00000033289
AA Change: D95G

PolyPhen 2 Score 0.774 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000033289
Gene: ENSMUSG00000030987
AA Change: D95G

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
low complexity region	32	47	N/A	INTRINSIC
SAM	129	200	5.51e-6	SMART
SCOP:d1eq1a_	229	334	1e-2	SMART
PDB:4O9B\|D	237	340	3e-59	PDB
Pfam:SOAR	341	441	1.4e-46	PFAM
low complexity region	485	499	N/A	INTRINSIC
low complexity region	601	631	N/A	INTRINSIC
low complexity region	672	685	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000209255
AA Change: D95G

PolyPhen 2 Score 0.917 (Sensitivity: 0.81; Specificity: 0.94)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000210266

Predicted Effect

possibly damaging
Transcript: ENSMUST00000211457
AA Change: D95G

PolyPhen 2 Score 0.846 (Sensitivity: 0.83; Specificity: 0.93)

Meta Mutation Damage Score

0.8009

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.2%
20x: 92.5%

Validation Efficiency

99% (74/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type 1 transmembrane protein that mediates Ca2+ influx after depletion of intracellular Ca2+ stores by gating of store-operated Ca2+ influx channels (SOCs). It is one of several genes located in the imprinted gene domain of 11p15.5, an important tumor-suppressor gene region. Alterations in this region have been associated with the Beckwith-Wiedemann syndrome, Wilms tumor, rhabdomyosarcoma, adrenocrotical carcinoma, and lung, ovarian, and breast cancer. This gene may play a role in malignancies and disease that involve this region, as well as early hematopoiesis, by mediating attachment to stromal cells. Mutations in this gene are associated with fatal classic Kaposi sarcoma, immunodeficiency due to defects in store-operated calcium entry (SOCE) in fibroblasts, ectodermal dysplasia and tubular aggregate myopathy. This gene is oriented in a head-to-tail configuration with the ribonucleotide reductase 1 gene (RRM1), with the 3' end of this gene situated 1.6 kb from the 5' end of the RRM1 gene. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a null allele exhibit perinatal and postnatal lethality, with all mice dying by 2 weeks of age, and severe growth retardation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700037C18Rik	T	A	16: 3,907,078	K45*	probably null	Het
Abcc1	T	A	16: 14,413,368	Y457N	probably damaging	Het
Actr3b	A	G	5: 25,812,011	D19G	probably damaging	Het
Adam39	T	C	8: 40,826,486	V638A	possibly damaging	Het
Adamts1	G	T	16: 85,796,817		probably benign	Het
AI661453	A	G	17: 47,467,866		probably benign	Het
Ank3	G	A	10: 69,884,802	S565N	probably benign	Het
Casd1	A	G	6: 4,621,243	E267G	probably benign	Het
Casr	T	C	16: 36,500,205	K527R	probably damaging	Het
Cep128	A	C	12: 91,325,532	S248A	probably damaging	Het
Clic4	A	G	4: 135,238,895	V50A	possibly damaging	Het
Cylc2	C	T	4: 51,225,173	A36V	probably benign	Het
Derl1	T	A	15: 57,878,559	M127L	probably benign	Het
Dnah6	A	G	6: 73,044,752	V3529A	possibly damaging	Het
Dock1	G	T	7: 135,098,779	L1089F	probably damaging	Het
Edil3	T	A	13: 89,289,576		probably null	Het
Ephb1	A	G	9: 101,996,825	V550A	probably damaging	Het
Fam129c	A	G	8: 71,600,164	D94G	probably benign	Het
Fcho2	G	A	13: 98,784,816	T187I	probably benign	Het
Gas6	T	C	8: 13,465,902		probably null	Het
Gdf7	T	C	12: 8,297,971	Y442C	probably damaging	Het
Gm11567	G	A	11: 99,879,797	G187E	unknown	Het
Gm11639	A	T	11: 104,698,978	T134S	probably benign	Het
Gm8674	T	C	13: 49,901,358		noncoding transcript	Het
Ift80	T	A	3: 68,916,157	I591F	probably benign	Het
Kcnn3	C	T	3: 89,520,497	S10L	unknown	Het
Keg1	A	G	19: 12,719,042	I197V	probably benign	Het
Klhdc9	A	G	1: 171,359,466		probably null	Het
Klhl11	A	G	11: 100,463,015	V660A	probably benign	Het
Lamc1	T	C	1: 153,258,072		probably benign	Het
Lrrc73	G	T	17: 46,255,340		probably null	Het
Lrriq1	G	A	10: 103,214,824	S689L	probably benign	Het
Magi2	A	G	5: 20,705,506		probably benign	Het
Meis1	A	G	11: 19,016,278	S32P	probably benign	Het
Mia2	A	G	12: 59,179,845		probably null	Het
Mlph	T	C	1: 90,941,734	L486P	probably damaging	Het
Myh10	A	G	11: 68,792,010	E1090G	probably damaging	Het
Mylk	T	C	16: 34,875,635	S247P	probably benign	Het
Naip2	C	T	13: 100,161,981	A516T	possibly damaging	Het
Ndufc1	T	C	3: 51,408,243	T25A	probably benign	Het
Nedd4l	A	G	18: 65,198,641	Y636C	probably damaging	Het
Nfib	A	T	4: 82,498,679	Y40N	probably damaging	Het
Nisch	T	C	14: 31,173,168	D1057G	probably damaging	Het
P3h2	T	C	16: 25,972,291	H475R	probably benign	Het
Pde6c	C	A	19: 38,161,958	T517K	possibly damaging	Het
Piezo2	T	C	18: 63,082,915	I994V	probably benign	Het
Pik3r4	A	G	9: 105,687,152	D1315G	possibly damaging	Het
Pip5k1c	T	G	10: 81,314,994	V46G	probably damaging	Het
Pole	A	G	5: 110,317,845	E1213G	probably damaging	Het
Prl7d1	T	C	13: 27,712,131	S88G	possibly damaging	Het
Prodh	T	A	16: 18,081,069	N72I	probably benign	Het
Prrc2a	G	A	17: 35,156,954	R907C	probably damaging	Het
Ptger2	T	A	14: 44,988,966	M1K	probably null	Het
Samd4b	G	C	7: 28,423,616	Q6E	probably damaging	Het
Sec24a	C	T	11: 51,704,385	R916H	probably benign	Het
Slc12a5	C	A	2: 164,994,027	D865E	probably benign	Het
Slc17a3	T	C	13: 23,857,198		probably benign	Het
Ssrp1	T	C	2: 85,041,185	V317A	possibly damaging	Het
Taok2	A	T	7: 126,875,938		probably benign	Het
Tcof1	T	G	18: 60,816,228	K1205T	possibly damaging	Het
Trim43c	C	T	9: 88,847,477	R325C	probably damaging	Het
Trub2	T	G	2: 29,777,936	T231P	probably damaging	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Uty	T	A	Y: 1,152,054	D724V	probably damaging	Het
Vmn2r98	A	G	17: 19,080,908	D724G	probably damaging	Het
Wdfy3	A	G	5: 101,875,915	I2442T	possibly damaging	Het
Wdfy4	T	C	14: 33,073,585		probably null	Het
Zfp280b	A	G	10: 76,039,610	H441R	probably damaging	Het
Zfp60	A	T	7: 27,736,975	Q7L	probably damaging	Het
Zzef1	T	C	11: 72,826,202	L406S	probably damaging	Het

Other mutations in Stim1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00990:Stim1	APN	7	102426747	missense	probably damaging	1.00
IGL01390:Stim1	APN	7	102427162	missense	possibly damaging	0.73
IGL01602:Stim1	APN	7	102386115	missense	possibly damaging	0.86
IGL01605:Stim1	APN	7	102386115	missense	possibly damaging	0.86
IGL01697:Stim1	APN	7	102425969	splice site	probably benign
IGL01826:Stim1	APN	7	102427075	splice site	probably benign
IGL01908:Stim1	APN	7	102435650	missense	probably benign
IGL02869:Stim1	APN	7	102268551	missense	unknown
IGL03146:Stim1	APN	7	102421355	missense	probably damaging	1.00
R0217:Stim1	UTSW	7	102435800	missense	probably benign	0.00
R1320:Stim1	UTSW	7	102408406	missense	possibly damaging	0.79
R1639:Stim1	UTSW	7	102354541	missense	probably benign	0.31
R1697:Stim1	UTSW	7	102354506	missense	probably damaging	1.00
R2424:Stim1	UTSW	7	102408405	missense	probably benign	0.03
R3838:Stim1	UTSW	7	102411296	missense	possibly damaging	0.71
R3940:Stim1	UTSW	7	102435641	missense	probably benign	0.00
R4820:Stim1	UTSW	7	102415364	missense	probably damaging	0.97
R4871:Stim1	UTSW	7	102354572	missense	probably damaging	1.00
R5110:Stim1	UTSW	7	102268422	missense	unknown
R5787:Stim1	UTSW	7	102435440	missense	possibly damaging	0.52
R6400:Stim1	UTSW	7	102430950	missense	probably null	0.99
R6788:Stim1	UTSW	7	102427291	missense	probably damaging	0.99
R7112:Stim1	UTSW	7	102408408	missense	probably benign	0.01
R7125:Stim1	UTSW	7	102435534	missense	possibly damaging	0.69
R7247:Stim1	UTSW	7	102421532	critical splice donor site	probably null
R7650:Stim1	UTSW	7	102428827	missense
R7807:Stim1	UTSW	7	102427141	missense	probably damaging	0.99
R8304:Stim1	UTSW	7	102435481	missense	possibly damaging	0.55
R8462:Stim1	UTSW	7	102427117	missense	probably damaging	1.00
R8528:Stim1	UTSW	7	102431082	intron	probably benign
R8883:Stim1	UTSW	7	102431050	missense	unknown
R8921:Stim1	UTSW	7	102421390	missense	probably damaging	0.99
R8924:Stim1	UTSW	7	102428807	missense
R9018:Stim1	UTSW	7	102411275	missense	probably benign	0.05
R9164:Stim1	UTSW	7	102435419	missense	probably benign	0.35
R9396:Stim1	UTSW	7	102415385	missense	possibly damaging	0.63
R9487:Stim1	UTSW	7	102431050	missense	unknown
R9501:Stim1	UTSW	7	102411299	missense	possibly damaging	0.92
R9697:Stim1	UTSW	7	102428807	missense
R9710:Stim1	UTSW	7	102430911	small deletion	probably benign
R9734:Stim1	UTSW	7	102415353	missense	possibly damaging	0.56

Predicted Primers

PCR Primer
(F):5'- ACCAGCAACTGAGGCATTCACATAG -3'
(R):5'- TCAAATCCCTTTCCCAGCATGACTG -3'

Sequencing Primer
(F):5'- CTGAGGCATTCACATAGAAAGATAC -3'
(R):5'- TTCCCAGCATGACTGTAATTTG -3'

Posted On

2014-04-24