Incidental Mutation 'R1643:Abcc1'
ID173708
Institutional Source Beutler Lab
Gene Symbol Abcc1
Ensembl Gene ENSMUSG00000023088
Gene NameATP-binding cassette, sub-family C (CFTR/MRP), member 1
SynonymsMrp1, Mdrap, MRP, Abcc1b, Abcc1a
MMRRC Submission 039679-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock #R1643 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location14361558-14475737 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 14413368 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 457 (Y457N)
Ref Sequence ENSEMBL: ENSMUSP00000097743 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100167] [ENSMUST00000130671] [ENSMUST00000133454] [ENSMUST00000147759]
Predicted Effect probably damaging
Transcript: ENSMUST00000100167
AA Change: Y457N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000097743
Gene: ENSMUSG00000023088
AA Change: Y457N

DomainStartEndE-ValueType
transmembrane domain 38 57 N/A INTRINSIC
transmembrane domain 77 94 N/A INTRINSIC
transmembrane domain 104 126 N/A INTRINSIC
transmembrane domain 139 161 N/A INTRINSIC
transmembrane domain 176 198 N/A INTRINSIC
low complexity region 279 290 N/A INTRINSIC
Pfam:ABC_membrane 326 597 7.8e-44 PFAM
AAA 670 845 4.07e-8 SMART
Pfam:ABC_membrane 971 1243 3e-52 PFAM
AAA 1316 1501 5.8e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000130671
AA Change: Y457N

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000116714
Gene: ENSMUSG00000023088
AA Change: Y457N

DomainStartEndE-ValueType
transmembrane domain 38 57 N/A INTRINSIC
transmembrane domain 77 94 N/A INTRINSIC
transmembrane domain 104 126 N/A INTRINSIC
transmembrane domain 139 161 N/A INTRINSIC
transmembrane domain 176 198 N/A INTRINSIC
low complexity region 279 290 N/A INTRINSIC
Pfam:ABC_membrane 326 597 1.6e-48 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000133454
AA Change: Y457N

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000122656
Gene: ENSMUSG00000023088
AA Change: Y457N

DomainStartEndE-ValueType
transmembrane domain 38 57 N/A INTRINSIC
transmembrane domain 77 94 N/A INTRINSIC
transmembrane domain 104 126 N/A INTRINSIC
transmembrane domain 139 161 N/A INTRINSIC
transmembrane domain 176 198 N/A INTRINSIC
low complexity region 279 290 N/A INTRINSIC
Pfam:ABC_membrane 326 597 1.6e-48 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000147759
AA Change: Y457N

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000115627
Gene: ENSMUSG00000023088
AA Change: Y457N

DomainStartEndE-ValueType
transmembrane domain 38 57 N/A INTRINSIC
transmembrane domain 77 94 N/A INTRINSIC
transmembrane domain 104 126 N/A INTRINSIC
transmembrane domain 139 161 N/A INTRINSIC
transmembrane domain 176 198 N/A INTRINSIC
low complexity region 279 290 N/A INTRINSIC
Pfam:ABC_membrane 326 597 1.6e-48 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156089
Meta Mutation Damage Score 0.9180 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.5%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This full transporter is a member of the MRP subfamily which is involved in multi-drug resistance. This protein plays an essential role in the defense against toxic compounds and serves as the major high-affinity transporter of leukotriene C4. The encoded protein may also play an essential role in steroid hormone homeostasis as a transporter for steroid hormones and their metabolites. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene have a reduced response to inflammatory stimulus, increased levels of glutathione due to impaired metabolism, and are hypersensitive to the anticancer drug etoposide. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700037C18Rik T A 16: 3,907,078 K45* probably null Het
Actr3b A G 5: 25,812,011 D19G probably damaging Het
Adam39 T C 8: 40,826,486 V638A possibly damaging Het
Adamts1 G T 16: 85,796,817 probably benign Het
AI661453 A G 17: 47,467,866 probably benign Het
Ank3 G A 10: 69,884,802 S565N probably benign Het
Casd1 A G 6: 4,621,243 E267G probably benign Het
Casr T C 16: 36,500,205 K527R probably damaging Het
Cep128 A C 12: 91,325,532 S248A probably damaging Het
Clic4 A G 4: 135,238,895 V50A possibly damaging Het
Cylc2 C T 4: 51,225,173 A36V probably benign Het
Derl1 T A 15: 57,878,559 M127L probably benign Het
Dnah6 A G 6: 73,044,752 V3529A possibly damaging Het
Dock1 G T 7: 135,098,779 L1089F probably damaging Het
Edil3 T A 13: 89,289,576 probably null Het
Ephb1 A G 9: 101,996,825 V550A probably damaging Het
Fam129c A G 8: 71,600,164 D94G probably benign Het
Fcho2 G A 13: 98,784,816 T187I probably benign Het
Gas6 T C 8: 13,465,902 probably null Het
Gdf7 T C 12: 8,297,971 Y442C probably damaging Het
Gm11567 G A 11: 99,879,797 G187E unknown Het
Gm11639 A T 11: 104,698,978 T134S probably benign Het
Gm8674 T C 13: 49,901,358 noncoding transcript Het
Ift80 T A 3: 68,916,157 I591F probably benign Het
Kcnn3 C T 3: 89,520,497 S10L unknown Het
Keg1 A G 19: 12,719,042 I197V probably benign Het
Klhdc9 A G 1: 171,359,466 probably null Het
Klhl11 A G 11: 100,463,015 V660A probably benign Het
Lamc1 T C 1: 153,258,072 probably benign Het
Lrrc73 G T 17: 46,255,340 probably null Het
Lrriq1 G A 10: 103,214,824 S689L probably benign Het
Magi2 A G 5: 20,705,506 probably benign Het
Meis1 A G 11: 19,016,278 S32P probably benign Het
Mia2 A G 12: 59,179,845 probably null Het
Mlph T C 1: 90,941,734 L486P probably damaging Het
Myh10 A G 11: 68,792,010 E1090G probably damaging Het
Mylk T C 16: 34,875,635 S247P probably benign Het
Naip2 C T 13: 100,161,981 A516T possibly damaging Het
Ndufc1 T C 3: 51,408,243 T25A probably benign Het
Nedd4l A G 18: 65,198,641 Y636C probably damaging Het
Nfib A T 4: 82,498,679 Y40N probably damaging Het
Nisch T C 14: 31,173,168 D1057G probably damaging Het
P3h2 T C 16: 25,972,291 H475R probably benign Het
Pde6c C A 19: 38,161,958 T517K possibly damaging Het
Piezo2 T C 18: 63,082,915 I994V probably benign Het
Pik3r4 A G 9: 105,687,152 D1315G possibly damaging Het
Pip5k1c T G 10: 81,314,994 V46G probably damaging Het
Pole A G 5: 110,317,845 E1213G probably damaging Het
Prl7d1 T C 13: 27,712,131 S88G possibly damaging Het
Prodh T A 16: 18,081,069 N72I probably benign Het
Prrc2a G A 17: 35,156,954 R907C probably damaging Het
Ptger2 T A 14: 44,988,966 M1K probably null Het
Samd4b G C 7: 28,423,616 Q6E probably damaging Het
Sec24a C T 11: 51,704,385 R916H probably benign Het
Slc12a5 C A 2: 164,994,027 D865E probably benign Het
Slc17a3 T C 13: 23,857,198 probably benign Het
Ssrp1 T C 2: 85,041,185 V317A possibly damaging Het
Stim1 A G 7: 102,386,100 D95G possibly damaging Het
Taok2 A T 7: 126,875,938 probably benign Het
Tcof1 T G 18: 60,816,228 K1205T possibly damaging Het
Trim43c C T 9: 88,847,477 R325C probably damaging Het
Trub2 T G 2: 29,777,936 T231P probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Uty T A Y: 1,152,054 D724V probably damaging Het
Vmn2r98 A G 17: 19,080,908 D724G probably damaging Het
Wdfy3 A G 5: 101,875,915 I2442T possibly damaging Het
Wdfy4 T C 14: 33,073,585 probably null Het
Zfp280b A G 10: 76,039,610 H441R probably damaging Het
Zfp60 A T 7: 27,736,975 Q7L probably damaging Het
Zzef1 T C 11: 72,826,202 L406S probably damaging Het
Other mutations in Abcc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Abcc1 APN 16 14460983 missense probably benign 0.34
IGL00094:Abcc1 APN 16 14470534 missense probably null 0.00
IGL00475:Abcc1 APN 16 14436573 missense probably damaging 1.00
IGL00516:Abcc1 APN 16 14413312 nonsense probably null
IGL00765:Abcc1 APN 16 14411508 missense probably damaging 0.99
IGL00792:Abcc1 APN 16 14410926 missense probably benign 0.18
IGL01678:Abcc1 APN 16 14405019 missense probably null 0.96
IGL01683:Abcc1 APN 16 14396424 missense probably damaging 1.00
IGL01955:Abcc1 APN 16 14410795 missense probably damaging 1.00
IGL02048:Abcc1 APN 16 14411519 missense probably damaging 0.98
IGL02345:Abcc1 APN 16 14396351 missense possibly damaging 0.95
IGL02366:Abcc1 APN 16 14467979 splice site probably benign
IGL02431:Abcc1 APN 16 14419734 missense probably damaging 1.00
IGL02480:Abcc1 APN 16 14404005 missense possibly damaging 0.87
IGL02651:Abcc1 APN 16 14466126 missense probably benign 0.00
IGL02902:Abcc1 APN 16 14423127 missense probably damaging 1.00
IGL03101:Abcc1 APN 16 14389868 missense probably damaging 1.00
IGL03230:Abcc1 APN 16 14457947 missense probably benign
IGL03308:Abcc1 APN 16 14470611 missense possibly damaging 0.55
PIT4544001:Abcc1 UTSW 16 14405079 missense probably damaging 1.00
R0310:Abcc1 UTSW 16 14410927 missense probably damaging 0.98
R0594:Abcc1 UTSW 16 14389880 missense probably benign 0.05
R0894:Abcc1 UTSW 16 14465137 missense possibly damaging 0.64
R0928:Abcc1 UTSW 16 14389985 critical splice donor site probably null
R1367:Abcc1 UTSW 16 14443386 missense probably damaging 1.00
R1496:Abcc1 UTSW 16 14448434 missense probably damaging 1.00
R1795:Abcc1 UTSW 16 14465137 missense possibly damaging 0.64
R1834:Abcc1 UTSW 16 14423117 missense possibly damaging 0.88
R1847:Abcc1 UTSW 16 14445449 missense probably benign 0.02
R1959:Abcc1 UTSW 16 14396393 missense probably damaging 1.00
R1961:Abcc1 UTSW 16 14396393 missense probably damaging 1.00
R2017:Abcc1 UTSW 16 14461204 missense probably damaging 1.00
R2224:Abcc1 UTSW 16 14472068 missense probably damaging 1.00
R2377:Abcc1 UTSW 16 14467923 missense probably damaging 0.97
R2513:Abcc1 UTSW 16 14473009 splice site probably null
R2876:Abcc1 UTSW 16 14457960 missense probably benign
R3003:Abcc1 UTSW 16 14436529 missense probably damaging 1.00
R3941:Abcc1 UTSW 16 14396399 missense probably benign 0.00
R4119:Abcc1 UTSW 16 14394013 missense probably benign 0.43
R4191:Abcc1 UTSW 16 14389864 missense probably damaging 1.00
R4369:Abcc1 UTSW 16 14460993 missense possibly damaging 0.88
R4428:Abcc1 UTSW 16 14445300 missense probably damaging 0.97
R4589:Abcc1 UTSW 16 14394031 missense probably benign 0.00
R4779:Abcc1 UTSW 16 14410771 missense probably benign 0.35
R5027:Abcc1 UTSW 16 14404053 critical splice donor site probably null
R5275:Abcc1 UTSW 16 14466186 missense probably damaging 1.00
R5418:Abcc1 UTSW 16 14461132 missense probably benign 0.02
R5490:Abcc1 UTSW 16 14410917 missense probably damaging 1.00
R5527:Abcc1 UTSW 16 14460978 missense probably benign 0.18
R5641:Abcc1 UTSW 16 14472013 missense probably benign 0.00
R5642:Abcc1 UTSW 16 14443455 missense probably damaging 1.00
R5875:Abcc1 UTSW 16 14467037 missense possibly damaging 0.94
R5916:Abcc1 UTSW 16 14465142 missense possibly damaging 0.95
R6112:Abcc1 UTSW 16 14460916 missense probably damaging 1.00
R6331:Abcc1 UTSW 16 14465056 missense probably damaging 0.97
R6464:Abcc1 UTSW 16 14447490 missense probably damaging 1.00
R6950:Abcc1 UTSW 16 14411616 missense probably damaging 1.00
R7024:Abcc1 UTSW 16 14413383 critical splice donor site probably null
R7115:Abcc1 UTSW 16 14437725 missense probably benign 0.11
R7187:Abcc1 UTSW 16 14466997 missense probably benign
R7298:Abcc1 UTSW 16 14396472 missense possibly damaging 0.89
R7342:Abcc1 UTSW 16 14465169 missense probably damaging 0.99
R7474:Abcc1 UTSW 16 14472986 missense possibly damaging 0.95
R7488:Abcc1 UTSW 16 14389899 nonsense probably null
R7583:Abcc1 UTSW 16 14404038 missense probably damaging 1.00
R7619:Abcc1 UTSW 16 14445419 missense probably damaging 0.96
R8048:Abcc1 UTSW 16 14410844 missense not run
X0026:Abcc1 UTSW 16 14459902 missense possibly damaging 0.94
Z1088:Abcc1 UTSW 16 14410809 missense probably benign 0.01
Z1177:Abcc1 UTSW 16 14411493 missense not run
Predicted Primers PCR Primer
(F):5'- TCCTGAACCCCACAGGCTCTTT -3'
(R):5'- GGTACAATCGAACAGAATTGGTGGGTTA -3'

Sequencing Primer
(F):5'- ACAGGCTCTTTTGATCACCAATG -3'
(R):5'- ctctctctctctctctctctctc -3'
Posted On2014-04-24