Mutagenetix > Incidental Mutation

Incidental Mutation 'R1643:P3h2'

173710

Institutional Source

Beutler Lab

Gene Symbol

P3h2

Ensembl Gene

ENSMUSG00000038168

Gene Name

prolyl 3-hydroxylase 2

Synonyms

Leprel1

MMRRC Submission

039679-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1643 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

25959288-26105784 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 25972291 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Arginine at position 475 (H475R)

Ref Sequence

ENSEMBL: ENSMUSP00000038056 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039990]

AlphaFold

Q8CG71

Predicted Effect

probably benign
Transcript: ENSMUST00000039990
AA Change: H475R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000038056
Gene: ENSMUSG00000038168
AA Change: H475R

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
low complexity region	27	36	N/A	INTRINSIC
Pfam:TPR_2	42	73	2.5e-5	PFAM
low complexity region	81	104	N/A	INTRINSIC
low complexity region	114	123	N/A	INTRINSIC
Pfam:TPR_2	206	237	1.2e-5	PFAM
low complexity region	253	266	N/A	INTRINSIC
internal_repeat_1	304	366	4.75e-7	PROSPERO
P4Hc	457	665	1.45e-51	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160067

Meta Mutation Damage Score

0.0578

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.2%
20x: 92.5%

Validation Efficiency

99% (74/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the prolyl 3-hydroxylase subfamily of 2-oxo-glutarate-dependent dioxygenases. These enzymes play a critical role in collagen chain assembly, stability and cross-linking by catalyzing post-translational 3-hydroxylation of proline residues. Mutations in this gene are associated with nonsyndromic severe myopia with cataract and vitreoretinal degeneration, and downregulation of this gene may play a role in breast cancer. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele of exon 2 exhibit embryonic lethality between E8.5 and E12.5 with maternal platelets aggregate around the ectoplacental cone. Exon 3 knockouts are viable but mice exhibit reduced hydroxylation of collagen chains, especially in the sclera, leading to eye tissue dysmorphology and progressive myopia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700037C18Rik	T	A	16: 3,907,078	K45*	probably null	Het
Abcc1	T	A	16: 14,413,368	Y457N	probably damaging	Het
Actr3b	A	G	5: 25,812,011	D19G	probably damaging	Het
Adam39	T	C	8: 40,826,486	V638A	possibly damaging	Het
Adamts1	G	T	16: 85,796,817		probably benign	Het
AI661453	A	G	17: 47,467,866		probably benign	Het
Ank3	G	A	10: 69,884,802	S565N	probably benign	Het
Casd1	A	G	6: 4,621,243	E267G	probably benign	Het
Casr	T	C	16: 36,500,205	K527R	probably damaging	Het
Cep128	A	C	12: 91,325,532	S248A	probably damaging	Het
Clic4	A	G	4: 135,238,895	V50A	possibly damaging	Het
Cylc2	C	T	4: 51,225,173	A36V	probably benign	Het
Derl1	T	A	15: 57,878,559	M127L	probably benign	Het
Dnah6	A	G	6: 73,044,752	V3529A	possibly damaging	Het
Dock1	G	T	7: 135,098,779	L1089F	probably damaging	Het
Edil3	T	A	13: 89,289,576		probably null	Het
Ephb1	A	G	9: 101,996,825	V550A	probably damaging	Het
Fam129c	A	G	8: 71,600,164	D94G	probably benign	Het
Fcho2	G	A	13: 98,784,816	T187I	probably benign	Het
Gas6	T	C	8: 13,465,902		probably null	Het
Gdf7	T	C	12: 8,297,971	Y442C	probably damaging	Het
Gm11567	G	A	11: 99,879,797	G187E	unknown	Het
Gm11639	A	T	11: 104,698,978	T134S	probably benign	Het
Gm8674	T	C	13: 49,901,358		noncoding transcript	Het
Ift80	T	A	3: 68,916,157	I591F	probably benign	Het
Kcnn3	C	T	3: 89,520,497	S10L	unknown	Het
Keg1	A	G	19: 12,719,042	I197V	probably benign	Het
Klhdc9	A	G	1: 171,359,466		probably null	Het
Klhl11	A	G	11: 100,463,015	V660A	probably benign	Het
Lamc1	T	C	1: 153,258,072		probably benign	Het
Lrrc73	G	T	17: 46,255,340		probably null	Het
Lrriq1	G	A	10: 103,214,824	S689L	probably benign	Het
Magi2	A	G	5: 20,705,506		probably benign	Het
Meis1	A	G	11: 19,016,278	S32P	probably benign	Het
Mia2	A	G	12: 59,179,845		probably null	Het
Mlph	T	C	1: 90,941,734	L486P	probably damaging	Het
Myh10	A	G	11: 68,792,010	E1090G	probably damaging	Het
Mylk	T	C	16: 34,875,635	S247P	probably benign	Het
Naip2	C	T	13: 100,161,981	A516T	possibly damaging	Het
Ndufc1	T	C	3: 51,408,243	T25A	probably benign	Het
Nedd4l	A	G	18: 65,198,641	Y636C	probably damaging	Het
Nfib	A	T	4: 82,498,679	Y40N	probably damaging	Het
Nisch	T	C	14: 31,173,168	D1057G	probably damaging	Het
Pde6c	C	A	19: 38,161,958	T517K	possibly damaging	Het
Piezo2	T	C	18: 63,082,915	I994V	probably benign	Het
Pik3r4	A	G	9: 105,687,152	D1315G	possibly damaging	Het
Pip5k1c	T	G	10: 81,314,994	V46G	probably damaging	Het
Pole	A	G	5: 110,317,845	E1213G	probably damaging	Het
Prl7d1	T	C	13: 27,712,131	S88G	possibly damaging	Het
Prodh	T	A	16: 18,081,069	N72I	probably benign	Het
Prrc2a	G	A	17: 35,156,954	R907C	probably damaging	Het
Ptger2	T	A	14: 44,988,966	M1K	probably null	Het
Samd4b	G	C	7: 28,423,616	Q6E	probably damaging	Het
Sec24a	C	T	11: 51,704,385	R916H	probably benign	Het
Slc12a5	C	A	2: 164,994,027	D865E	probably benign	Het
Slc17a3	T	C	13: 23,857,198		probably benign	Het
Ssrp1	T	C	2: 85,041,185	V317A	possibly damaging	Het
Stim1	A	G	7: 102,386,100	D95G	possibly damaging	Het
Taok2	A	T	7: 126,875,938		probably benign	Het
Tcof1	T	G	18: 60,816,228	K1205T	possibly damaging	Het
Trim43c	C	T	9: 88,847,477	R325C	probably damaging	Het
Trub2	T	G	2: 29,777,936	T231P	probably damaging	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Uty	T	A	Y: 1,152,054	D724V	probably damaging	Het
Vmn2r98	A	G	17: 19,080,908	D724G	probably damaging	Het
Wdfy3	A	G	5: 101,875,915	I2442T	possibly damaging	Het
Wdfy4	T	C	14: 33,073,585		probably null	Het
Zfp280b	A	G	10: 76,039,610	H441R	probably damaging	Het
Zfp60	A	T	7: 27,736,975	Q7L	probably damaging	Het
Zzef1	T	C	11: 72,826,202	L406S	probably damaging	Het

Other mutations in P3h2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00825:P3h2	APN	16	25992798	missense	probably damaging	1.00
IGL01012:P3h2	APN	16	25987248	missense	probably damaging	0.98
IGL02393:P3h2	APN	16	25992825	missense	probably damaging	1.00
IGL02436:P3h2	APN	16	25997200	missense	probably benign	0.01
PIT4445001:P3h2	UTSW	16	25984999	missense	probably benign	0.01
R0319:P3h2	UTSW	16	25970931	missense	possibly damaging	0.93
R0403:P3h2	UTSW	16	25969950	missense	possibly damaging	0.63
R0962:P3h2	UTSW	16	25997248	missense	probably benign
R1290:P3h2	UTSW	16	25987203	missense	probably damaging	0.99
R1300:P3h2	UTSW	16	25997236	nonsense	probably null
R1467:P3h2	UTSW	16	25965868	splice site	probably benign
R1645:P3h2	UTSW	16	25997232	missense	probably damaging	1.00
R1761:P3h2	UTSW	16	25985050	missense	probably damaging	0.96
R4227:P3h2	UTSW	16	26105453	missense	probably benign
R4273:P3h2	UTSW	16	26105221	missense	probably benign	0.00
R4409:P3h2	UTSW	16	26105290	missense	possibly damaging	0.88
R4410:P3h2	UTSW	16	26105290	missense	possibly damaging	0.88
R4653:P3h2	UTSW	16	26105277	missense	probably damaging	0.98
R4968:P3h2	UTSW	16	25992662	critical splice donor site	probably null
R5190:P3h2	UTSW	16	25984949	missense	possibly damaging	0.86
R6113:P3h2	UTSW	16	25981153	missense	probably benign	0.01
R6225:P3h2	UTSW	16	25965743	missense	probably damaging	0.97
R6838:P3h2	UTSW	16	26105284	missense	possibly damaging	0.73
R6881:P3h2	UTSW	16	25992745	missense	probably damaging	1.00
R7089:P3h2	UTSW	16	25965809	missense	probably damaging	1.00
R7445:P3h2	UTSW	16	25985065	missense	probably damaging	0.96
R7753:P3h2	UTSW	16	25970937	missense	probably damaging	1.00
R8166:P3h2	UTSW	16	25992822	missense	possibly damaging	0.89
R8363:P3h2	UTSW	16	25992718	missense	probably damaging	0.98
R8442:P3h2	UTSW	16	25987205	missense	probably benign	0.05
R8812:P3h2	UTSW	16	25982717	missense	possibly damaging	0.67
R8965:P3h2	UTSW	16	25972384	missense	probably benign	0.41
R9187:P3h2	UTSW	16	26105436	missense	probably benign	0.27
R9193:P3h2	UTSW	16	26105241	missense	probably benign	0.07
R9533:P3h2	UTSW	16	25970975	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCTACATGGCTACTCTCCGAAGAAC -3'
(R):5'- TCTCCATTGCAGACTGGCTGTTG -3'

Sequencing Primer
(F):5'- GTGGGAGTTTCAGATTATTCCAACC -3'
(R):5'- TGGGTTTTCCGTGCTCC -3'

Posted On

2014-04-24