Incidental Mutation 'R1643:Mylk'
ID 173711
Institutional Source Beutler Lab
Gene Symbol Mylk
Ensembl Gene ENSMUSG00000022836
Gene Name myosin, light polypeptide kinase
Synonyms Mlck, nmMlck, telokin, A930019C19Rik, 9530072E15Rik, MLCK108, MLCK210
MMRRC Submission 039679-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R1643 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 34745210-35002420 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 34875635 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 247 (S247P)
Ref Sequence ENSEMBL: ENSMUSP00000023538 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023538]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000023538
AA Change: S247P

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000023538
Gene: ENSMUSG00000022836
AA Change: S247P

DomainStartEndE-ValueType
IGc2 54 122 9.05e-11 SMART
IGc2 177 244 3.94e-11 SMART
Pfam:23ISL 255 409 3.6e-60 PFAM
IGc2 423 491 1.55e-9 SMART
IGc2 523 587 3.32e-18 SMART
IGc2 632 699 6.02e-7 SMART
IGc2 730 798 1.36e-5 SMART
low complexity region 827 844 N/A INTRINSIC
IGc2 1141 1208 2.42e-11 SMART
low complexity region 1251 1269 N/A INTRINSIC
IG 1275 1359 4.56e-7 SMART
FN3 1362 1444 2.33e-11 SMART
low complexity region 1457 1479 N/A INTRINSIC
S_TKc 1495 1750 4.23e-95 SMART
IGc2 1852 1920 5.92e-15 SMART
low complexity region 1934 1950 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155268
Meta Mutation Damage Score 0.1547 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.5%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, a muscle member of the immunoglobulin gene superfamily, encodes myosin light chain kinase which is a calcium/calmodulin dependent enzyme. This kinase phosphorylates myosin regulatory light chains to facilitate myosin interaction with actin filaments to produce contractile activity. This gene encodes both smooth muscle and nonmuscle isoforms. In addition, using a separate promoter in an intron in the 3' region, it encodes telokin, a small protein identical in sequence to the C-terminus of myosin light chain kinase, that is independently expressed in smooth muscle and functions to stabilize unphosphorylated myosin filaments. A pseudogene is located on the p arm of chromosome 3. Four transcript variants that produce four isoforms of the calcium/calmodulin dependent enzyme have been identified as well as two transcripts that produce two isoforms of telokin. Additional variants have been identified but lack full length transcripts. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice that lack the isoform abundant in endothelial cells show a reduced susceptibility to acute lung injury. Mice lacking the smooth muscle isoform exhibit partial pre- or neonatal lethality, short small intestine and impaired smooth muscle contraction in the colon. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700037C18Rik T A 16: 3,907,078 K45* probably null Het
Abcc1 T A 16: 14,413,368 Y457N probably damaging Het
Actr3b A G 5: 25,812,011 D19G probably damaging Het
Adam39 T C 8: 40,826,486 V638A possibly damaging Het
Adamts1 G T 16: 85,796,817 probably benign Het
AI661453 A G 17: 47,467,866 probably benign Het
Ank3 G A 10: 69,884,802 S565N probably benign Het
Casd1 A G 6: 4,621,243 E267G probably benign Het
Casr T C 16: 36,500,205 K527R probably damaging Het
Cep128 A C 12: 91,325,532 S248A probably damaging Het
Clic4 A G 4: 135,238,895 V50A possibly damaging Het
Cylc2 C T 4: 51,225,173 A36V probably benign Het
Derl1 T A 15: 57,878,559 M127L probably benign Het
Dnah6 A G 6: 73,044,752 V3529A possibly damaging Het
Dock1 G T 7: 135,098,779 L1089F probably damaging Het
Edil3 T A 13: 89,289,576 probably null Het
Ephb1 A G 9: 101,996,825 V550A probably damaging Het
Fam129c A G 8: 71,600,164 D94G probably benign Het
Fcho2 G A 13: 98,784,816 T187I probably benign Het
Gas6 T C 8: 13,465,902 probably null Het
Gdf7 T C 12: 8,297,971 Y442C probably damaging Het
Gm11567 G A 11: 99,879,797 G187E unknown Het
Gm11639 A T 11: 104,698,978 T134S probably benign Het
Gm8674 T C 13: 49,901,358 noncoding transcript Het
Ift80 T A 3: 68,916,157 I591F probably benign Het
Kcnn3 C T 3: 89,520,497 S10L unknown Het
Keg1 A G 19: 12,719,042 I197V probably benign Het
Klhdc9 A G 1: 171,359,466 probably null Het
Klhl11 A G 11: 100,463,015 V660A probably benign Het
Lamc1 T C 1: 153,258,072 probably benign Het
Lrrc73 G T 17: 46,255,340 probably null Het
Lrriq1 G A 10: 103,214,824 S689L probably benign Het
Magi2 A G 5: 20,705,506 probably benign Het
Meis1 A G 11: 19,016,278 S32P probably benign Het
Mia2 A G 12: 59,179,845 probably null Het
Mlph T C 1: 90,941,734 L486P probably damaging Het
Myh10 A G 11: 68,792,010 E1090G probably damaging Het
Naip2 C T 13: 100,161,981 A516T possibly damaging Het
Ndufc1 T C 3: 51,408,243 T25A probably benign Het
Nedd4l A G 18: 65,198,641 Y636C probably damaging Het
Nfib A T 4: 82,498,679 Y40N probably damaging Het
Nisch T C 14: 31,173,168 D1057G probably damaging Het
P3h2 T C 16: 25,972,291 H475R probably benign Het
Pde6c C A 19: 38,161,958 T517K possibly damaging Het
Piezo2 T C 18: 63,082,915 I994V probably benign Het
Pik3r4 A G 9: 105,687,152 D1315G possibly damaging Het
Pip5k1c T G 10: 81,314,994 V46G probably damaging Het
Pole A G 5: 110,317,845 E1213G probably damaging Het
Prl7d1 T C 13: 27,712,131 S88G possibly damaging Het
Prodh T A 16: 18,081,069 N72I probably benign Het
Prrc2a G A 17: 35,156,954 R907C probably damaging Het
Ptger2 T A 14: 44,988,966 M1K probably null Het
Samd4b G C 7: 28,423,616 Q6E probably damaging Het
Sec24a C T 11: 51,704,385 R916H probably benign Het
Slc12a5 C A 2: 164,994,027 D865E probably benign Het
Slc17a3 T C 13: 23,857,198 probably benign Het
Ssrp1 T C 2: 85,041,185 V317A possibly damaging Het
Stim1 A G 7: 102,386,100 D95G possibly damaging Het
Taok2 A T 7: 126,875,938 probably benign Het
Tcof1 T G 18: 60,816,228 K1205T possibly damaging Het
Trim43c C T 9: 88,847,477 R325C probably damaging Het
Trub2 T G 2: 29,777,936 T231P probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Uty T A Y: 1,152,054 D724V probably damaging Het
Vmn2r98 A G 17: 19,080,908 D724G probably damaging Het
Wdfy3 A G 5: 101,875,915 I2442T possibly damaging Het
Wdfy4 T C 14: 33,073,585 probably null Het
Zfp280b A G 10: 76,039,610 H441R probably damaging Het
Zfp60 A T 7: 27,736,975 Q7L probably damaging Het
Zzef1 T C 11: 72,826,202 L406S probably damaging Het
Other mutations in Mylk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01384:Mylk APN 16 34938952 missense probably benign 0.36
IGL01386:Mylk APN 16 34971240 critical splice acceptor site probably null
IGL01684:Mylk APN 16 34971940 missense possibly damaging 0.55
IGL01884:Mylk APN 16 34988877 splice site probably benign
IGL02079:Mylk APN 16 34860631 missense possibly damaging 0.87
IGL02104:Mylk APN 16 34815435 missense probably benign 0.06
IGL02624:Mylk APN 16 34929896 missense probably benign 0.29
IGL02756:Mylk APN 16 34963646 missense probably benign 0.42
IGL02794:Mylk APN 16 34986541 missense probably benign 0.21
IGL02833:Mylk APN 16 34914900 missense probably benign 0.01
IGL02946:Mylk APN 16 34921788 missense probably benign 0.10
IGL03012:Mylk APN 16 34952781 missense probably benign 0.03
IGL03093:Mylk APN 16 34912192 missense possibly damaging 0.62
IGL03272:Mylk APN 16 34979189 missense probably benign 0.09
billy UTSW 16 34875620 missense probably damaging 0.97
brutus UTSW 16 34953695 missense probably benign 0.12
Club UTSW 16 34912275 nonsense probably null
popeye UTSW 16 34963577 missense probably benign 0.29
F5770:Mylk UTSW 16 34995204 critical splice donor site probably null
P4717OSA:Mylk UTSW 16 34977113 splice site probably benign
PIT4382001:Mylk UTSW 16 34875642 missense probably damaging 0.99
R0131:Mylk UTSW 16 34875504 missense probably benign 0.03
R0309:Mylk UTSW 16 34912297 splice site probably benign
R0358:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0381:Mylk UTSW 16 34784974 splice site probably null
R0390:Mylk UTSW 16 34875620 missense probably damaging 0.97
R0413:Mylk UTSW 16 34921944 missense probably benign 0.01
R0536:Mylk UTSW 16 35000387 missense possibly damaging 0.95
R0544:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0545:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0546:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0547:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0548:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0627:Mylk UTSW 16 35000429 missense probably damaging 1.00
R0726:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0755:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0782:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0783:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0784:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R1136:Mylk UTSW 16 35000318 missense probably damaging 1.00
R1170:Mylk UTSW 16 34874039 missense probably benign 0.20
R1222:Mylk UTSW 16 34860652 missense probably benign 0.12
R1445:Mylk UTSW 16 34815465 missense possibly damaging 0.57
R1583:Mylk UTSW 16 34875586 missense probably benign 0.29
R1618:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R1702:Mylk UTSW 16 34921944 missense probably benign 0.00
R1776:Mylk UTSW 16 34952782 missense probably benign 0.16
R1865:Mylk UTSW 16 34912230 missense probably benign 0.03
R1975:Mylk UTSW 16 34880303 splice site probably null
R2016:Mylk UTSW 16 34996817 missense probably damaging 1.00
R2045:Mylk UTSW 16 34953653 missense probably benign 0.29
R2134:Mylk UTSW 16 34986476 missense probably benign 0.13
R3547:Mylk UTSW 16 34880168 missense possibly damaging 0.61
R3844:Mylk UTSW 16 34921877 missense probably benign 0.01
R4003:Mylk UTSW 16 34963577 missense probably benign 0.29
R4396:Mylk UTSW 16 34912275 nonsense probably null
R4470:Mylk UTSW 16 34912152 missense probably benign 0.09
R4507:Mylk UTSW 16 34953695 missense probably benign 0.12
R4700:Mylk UTSW 16 34922435 missense probably benign 0.16
R4751:Mylk UTSW 16 34879169 missense probably benign 0.29
R4815:Mylk UTSW 16 34894925 missense probably damaging 0.97
R4832:Mylk UTSW 16 34922367 missense probably benign 0.36
R4872:Mylk UTSW 16 34914990 missense possibly damaging 0.89
R4953:Mylk UTSW 16 34988961 missense probably damaging 1.00
R4969:Mylk UTSW 16 34971440 missense probably damaging 0.96
R5009:Mylk UTSW 16 34899507 missense probably benign 0.39
R5130:Mylk UTSW 16 34988997 missense probably damaging 1.00
R5173:Mylk UTSW 16 34977013 missense probably benign 0.40
R5195:Mylk UTSW 16 34979215 missense probably damaging 1.00
R5209:Mylk UTSW 16 34922625 missense possibly damaging 0.55
R5311:Mylk UTSW 16 34921757 missense probably benign 0.01
R5418:Mylk UTSW 16 34912230 missense probably benign 0.02
R5481:Mylk UTSW 16 34921604 missense probably benign 0.09
R5590:Mylk UTSW 16 34879352 missense probably benign 0.29
R5603:Mylk UTSW 16 34956492 missense probably benign 0.06
R5823:Mylk UTSW 16 34894947 critical splice donor site probably null
R6290:Mylk UTSW 16 34894843 missense probably benign 0.39
R6351:Mylk UTSW 16 34921971 missense probably benign 0.01
R6365:Mylk UTSW 16 34860591 missense probably benign 0.12
R6490:Mylk UTSW 16 34929867 missense possibly damaging 0.74
R6723:Mylk UTSW 16 34929888 missense possibly damaging 0.74
R6864:Mylk UTSW 16 34874150 missense probably benign 0.03
R6908:Mylk UTSW 16 34880273 missense probably benign 0.18
R6949:Mylk UTSW 16 35000318 missense probably damaging 1.00
R7018:Mylk UTSW 16 35000426 missense possibly damaging 0.88
R7035:Mylk UTSW 16 34976982 missense possibly damaging 0.89
R7162:Mylk UTSW 16 34922529 missense probably damaging 1.00
R7236:Mylk UTSW 16 34922529 missense probably damaging 1.00
R7269:Mylk UTSW 16 34785011 missense probably damaging 0.96
R7475:Mylk UTSW 16 34914076 splice site probably null
R7525:Mylk UTSW 16 34988987 missense probably benign 0.06
R7587:Mylk UTSW 16 34922517 missense probably benign 0.29
R7607:Mylk UTSW 16 34894814 missense probably benign 0.09
R7616:Mylk UTSW 16 34879557 missense probably damaging 0.97
R7647:Mylk UTSW 16 34879524 missense probably benign 0.29
R7648:Mylk UTSW 16 34879524 missense probably benign 0.29
R7764:Mylk UTSW 16 34922183 missense probably benign 0.16
R7890:Mylk UTSW 16 34963648 nonsense probably null
R7892:Mylk UTSW 16 34879524 missense probably benign 0.29
R7893:Mylk UTSW 16 34879524 missense probably benign 0.29
R8065:Mylk UTSW 16 34972019 missense probably benign 0.08
R8067:Mylk UTSW 16 34972019 missense probably benign 0.08
R8143:Mylk UTSW 16 34914155 missense possibly damaging 0.87
R8210:Mylk UTSW 16 35000351 missense probably damaging 1.00
R8271:Mylk UTSW 16 34922579 missense probably damaging 0.97
R8540:Mylk UTSW 16 34929887 missense possibly damaging 0.87
R8721:Mylk UTSW 16 34996806 missense probably damaging 1.00
R8743:Mylk UTSW 16 34921057 missense probably benign 0.03
R8798:Mylk UTSW 16 34899402 missense possibly damaging 0.89
R8956:Mylk UTSW 16 34971409 missense probably benign 0.01
R9131:Mylk UTSW 16 34956465 missense probably benign 0.29
R9403:Mylk UTSW 16 34875642 nonsense probably null
R9624:Mylk UTSW 16 34879307 missense probably benign 0.29
R9735:Mylk UTSW 16 34914809 missense probably benign 0.09
R9756:Mylk UTSW 16 34914017 missense probably damaging 0.96
R9763:Mylk UTSW 16 34879112 nonsense probably null
RF001:Mylk UTSW 16 34879371 missense probably benign 0.03
V7580:Mylk UTSW 16 34995204 critical splice donor site probably null
V7583:Mylk UTSW 16 34995204 critical splice donor site probably null
X0065:Mylk UTSW 16 35000441 missense probably damaging 1.00
Z1177:Mylk UTSW 16 34922651 missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- GTACTCAAGCCCTGGTGTCCATTC -3'
(R):5'- CAGGCAGCTCATAGCATCTTCCTC -3'

Sequencing Primer
(F):5'- CCAACTGGGTCAAAGAGAGC -3'
(R):5'- GCTCATAGCATCTTCCTCTAGGC -3'
Posted On 2014-04-24