Mutagenetix > Incidental Mutation

Incidental Mutation 'R1643:Vmn2r98'

173715

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r98

Ensembl Gene

ENSMUSG00000096717

Gene Name

vomeronasal 2, receptor 98

Synonyms

EG224552

MMRRC Submission

039679-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.139) question?

Stock #

R1643 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

19053460-19082411 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 19080908 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 724 (D724G)

Ref Sequence

ENSEMBL: ENSMUSP00000131261 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000170424]

AlphaFold

E9PZ56

Predicted Effect

probably damaging
Transcript: ENSMUST00000170424
AA Change: D724G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000131261
Gene: ENSMUSG00000096717
AA Change: D724G

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:ANF_receptor	82	460	2.6e-35	PFAM
Pfam:NCD3G	509	562	7.4e-22	PFAM
Pfam:7tm_3	594	830	1.4e-52	PFAM
low complexity region	844	856	N/A	INTRINSIC

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.2%
20x: 92.5%

Validation Efficiency

99% (74/75)

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700037C18Rik	T	A	16: 3,907,078	K45*	probably null	Het
Abcc1	T	A	16: 14,413,368	Y457N	probably damaging	Het
Actr3b	A	G	5: 25,812,011	D19G	probably damaging	Het
Adam39	T	C	8: 40,826,486	V638A	possibly damaging	Het
Adamts1	G	T	16: 85,796,817		probably benign	Het
AI661453	A	G	17: 47,467,866		probably benign	Het
Ank3	G	A	10: 69,884,802	S565N	probably benign	Het
Casd1	A	G	6: 4,621,243	E267G	probably benign	Het
Casr	T	C	16: 36,500,205	K527R	probably damaging	Het
Cep128	A	C	12: 91,325,532	S248A	probably damaging	Het
Clic4	A	G	4: 135,238,895	V50A	possibly damaging	Het
Cylc2	C	T	4: 51,225,173	A36V	probably benign	Het
Derl1	T	A	15: 57,878,559	M127L	probably benign	Het
Dnah6	A	G	6: 73,044,752	V3529A	possibly damaging	Het
Dock1	G	T	7: 135,098,779	L1089F	probably damaging	Het
Edil3	T	A	13: 89,289,576		probably null	Het
Ephb1	A	G	9: 101,996,825	V550A	probably damaging	Het
Fam129c	A	G	8: 71,600,164	D94G	probably benign	Het
Fcho2	G	A	13: 98,784,816	T187I	probably benign	Het
Gas6	T	C	8: 13,465,902		probably null	Het
Gdf7	T	C	12: 8,297,971	Y442C	probably damaging	Het
Gm11567	G	A	11: 99,879,797	G187E	unknown	Het
Gm11639	A	T	11: 104,698,978	T134S	probably benign	Het
Gm8674	T	C	13: 49,901,358		noncoding transcript	Het
Ift80	T	A	3: 68,916,157	I591F	probably benign	Het
Kcnn3	C	T	3: 89,520,497	S10L	unknown	Het
Keg1	A	G	19: 12,719,042	I197V	probably benign	Het
Klhdc9	A	G	1: 171,359,466		probably null	Het
Klhl11	A	G	11: 100,463,015	V660A	probably benign	Het
Lamc1	T	C	1: 153,258,072		probably benign	Het
Lrrc73	G	T	17: 46,255,340		probably null	Het
Lrriq1	G	A	10: 103,214,824	S689L	probably benign	Het
Magi2	A	G	5: 20,705,506		probably benign	Het
Meis1	A	G	11: 19,016,278	S32P	probably benign	Het
Mia2	A	G	12: 59,179,845		probably null	Het
Mlph	T	C	1: 90,941,734	L486P	probably damaging	Het
Myh10	A	G	11: 68,792,010	E1090G	probably damaging	Het
Mylk	T	C	16: 34,875,635	S247P	probably benign	Het
Naip2	C	T	13: 100,161,981	A516T	possibly damaging	Het
Ndufc1	T	C	3: 51,408,243	T25A	probably benign	Het
Nedd4l	A	G	18: 65,198,641	Y636C	probably damaging	Het
Nfib	A	T	4: 82,498,679	Y40N	probably damaging	Het
Nisch	T	C	14: 31,173,168	D1057G	probably damaging	Het
P3h2	T	C	16: 25,972,291	H475R	probably benign	Het
Pde6c	C	A	19: 38,161,958	T517K	possibly damaging	Het
Piezo2	T	C	18: 63,082,915	I994V	probably benign	Het
Pik3r4	A	G	9: 105,687,152	D1315G	possibly damaging	Het
Pip5k1c	T	G	10: 81,314,994	V46G	probably damaging	Het
Pole	A	G	5: 110,317,845	E1213G	probably damaging	Het
Prl7d1	T	C	13: 27,712,131	S88G	possibly damaging	Het
Prodh	T	A	16: 18,081,069	N72I	probably benign	Het
Prrc2a	G	A	17: 35,156,954	R907C	probably damaging	Het
Ptger2	T	A	14: 44,988,966	M1K	probably null	Het
Samd4b	G	C	7: 28,423,616	Q6E	probably damaging	Het
Sec24a	C	T	11: 51,704,385	R916H	probably benign	Het
Slc12a5	C	A	2: 164,994,027	D865E	probably benign	Het
Slc17a3	T	C	13: 23,857,198		probably benign	Het
Ssrp1	T	C	2: 85,041,185	V317A	possibly damaging	Het
Stim1	A	G	7: 102,386,100	D95G	possibly damaging	Het
Taok2	A	T	7: 126,875,938		probably benign	Het
Tcof1	T	G	18: 60,816,228	K1205T	possibly damaging	Het
Trim43c	C	T	9: 88,847,477	R325C	probably damaging	Het
Trub2	T	G	2: 29,777,936	T231P	probably damaging	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Uty	T	A	Y: 1,152,054	D724V	probably damaging	Het
Wdfy3	A	G	5: 101,875,915	I2442T	possibly damaging	Het
Wdfy4	T	C	14: 33,073,585		probably null	Het
Zfp280b	A	G	10: 76,039,610	H441R	probably damaging	Het
Zfp60	A	T	7: 27,736,975	Q7L	probably damaging	Het
Zzef1	T	C	11: 72,826,202	L406S	probably damaging	Het

Other mutations in Vmn2r98

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00897:Vmn2r98	APN	17	19065745	splice site	probably benign
IGL01296:Vmn2r98	APN	17	19065185	missense	probably damaging	1.00
IGL01363:Vmn2r98	APN	17	19065758	missense	probably benign	0.01
IGL01618:Vmn2r98	APN	17	19065259	missense	possibly damaging	0.93
IGL01746:Vmn2r98	APN	17	19066451	missense	probably damaging	1.00
IGL01747:Vmn2r98	APN	17	19066440	missense	probably damaging	1.00
IGL01770:Vmn2r98	APN	17	19066440	missense	probably damaging	1.00
IGL01868:Vmn2r98	APN	17	19066286	missense	probably benign
IGL02123:Vmn2r98	APN	17	19080679	missense	probably damaging	1.00
IGL02323:Vmn2r98	APN	17	19065851	missense	probably damaging	0.99
IGL02543:Vmn2r98	APN	17	19065821	missense	probably benign
IGL02650:Vmn2r98	APN	17	19080961	missense	probably benign	0.00
IGL02676:Vmn2r98	APN	17	19065259	missense	probably benign	0.00
IGL02803:Vmn2r98	APN	17	19066013	missense	probably benign
IGL02807:Vmn2r98	APN	17	19081021	missense	probably damaging	1.00
IGL03307:Vmn2r98	APN	17	19065980	missense	possibly damaging	0.62
IGL03396:Vmn2r98	APN	17	19069845	missense	possibly damaging	0.92
PIT4131001:Vmn2r98	UTSW	17	19080961	missense	probably benign	0.00
R0122:Vmn2r98	UTSW	17	19066400	missense	probably benign	0.06
R0329:Vmn2r98	UTSW	17	19066347	missense	probably benign	0.21
R0330:Vmn2r98	UTSW	17	19066347	missense	probably benign	0.21
R0368:Vmn2r98	UTSW	17	19065827	nonsense	probably null
R0545:Vmn2r98	UTSW	17	19053613	missense	probably benign	0.15
R0635:Vmn2r98	UTSW	17	19080497	missense	probably benign	0.00
R0689:Vmn2r98	UTSW	17	19080520	missense	possibly damaging	0.83
R1035:Vmn2r98	UTSW	17	19080749	missense	possibly damaging	0.90
R1243:Vmn2r98	UTSW	17	19065948	missense	possibly damaging	0.52
R1421:Vmn2r98	UTSW	17	19065178	missense	probably damaging	1.00
R1629:Vmn2r98	UTSW	17	19067383	missense	possibly damaging	0.94
R1795:Vmn2r98	UTSW	17	19066440	missense	probably damaging	1.00
R1958:Vmn2r98	UTSW	17	19066418	missense	possibly damaging	0.70
R1962:Vmn2r98	UTSW	17	19065333	nonsense	probably null
R2165:Vmn2r98	UTSW	17	19081291	missense	unknown
R2238:Vmn2r98	UTSW	17	19065951	missense	probably damaging	1.00
R2252:Vmn2r98	UTSW	17	19080436	missense	probably benign	0.00
R2323:Vmn2r98	UTSW	17	19065819	missense	probably benign	0.18
R2887:Vmn2r98	UTSW	17	19081177	missense	possibly damaging	0.83
R2909:Vmn2r98	UTSW	17	19067402	missense	probably damaging	1.00
R3001:Vmn2r98	UTSW	17	19065863	missense	probably benign	0.01
R3002:Vmn2r98	UTSW	17	19065863	missense	probably benign	0.01
R3003:Vmn2r98	UTSW	17	19065863	missense	probably benign	0.01
R3788:Vmn2r98	UTSW	17	19080625	missense	probably benign	0.31
R4570:Vmn2r98	UTSW	17	19066092	missense	probably benign	0.11
R4706:Vmn2r98	UTSW	17	19069745	missense	probably damaging	1.00
R4723:Vmn2r98	UTSW	17	19066340	missense	probably benign	0.01
R5036:Vmn2r98	UTSW	17	19066157	missense	probably benign	0.00
R5072:Vmn2r98	UTSW	17	19066044	missense	probably benign	0.07
R5121:Vmn2r98	UTSW	17	19053553	missense	probably benign	0.13
R5283:Vmn2r98	UTSW	17	19080719	missense	probably benign	0.05
R5294:Vmn2r98	UTSW	17	19069754	nonsense	probably null
R5371:Vmn2r98	UTSW	17	19069753	missense	probably damaging	1.00
R5532:Vmn2r98	UTSW	17	19067383	missense	possibly damaging	0.94
R5598:Vmn2r98	UTSW	17	19080899	missense	probably benign	0.37
R5800:Vmn2r98	UTSW	17	19065998	missense	probably benign	0.17
R6089:Vmn2r98	UTSW	17	19066074	missense	probably benign	0.29
R6155:Vmn2r98	UTSW	17	19065881	missense	possibly damaging	0.87
R6853:Vmn2r98	UTSW	17	19065801	missense	probably benign	0.00
R6920:Vmn2r98	UTSW	17	19065248	missense	probably damaging	0.98
R7012:Vmn2r98	UTSW	17	19066268	missense	probably benign	0.06
R7042:Vmn2r98	UTSW	17	19080922	missense	probably benign
R7068:Vmn2r98	UTSW	17	19065313	missense	probably benign
R7607:Vmn2r98	UTSW	17	19067308	missense	possibly damaging	0.95
R7763:Vmn2r98	UTSW	17	19080535	missense	probably benign	0.00
R7771:Vmn2r98	UTSW	17	19067198	splice site	probably null
R7915:Vmn2r98	UTSW	17	19067231	missense	probably benign	0.10
R8028:Vmn2r98	UTSW	17	19053650	missense	probably benign	0.00
R8205:Vmn2r98	UTSW	17	19081163	missense	probably damaging	0.99
R8241:Vmn2r98	UTSW	17	19080769	missense	probably damaging	0.99
R8906:Vmn2r98	UTSW	17	19066270	missense	probably benign
R8952:Vmn2r98	UTSW	17	19065269	missense	possibly damaging	0.76
R9147:Vmn2r98	UTSW	17	19066121	missense	probably benign	0.04
R9148:Vmn2r98	UTSW	17	19066121	missense	probably benign	0.04
R9187:Vmn2r98	UTSW	17	19081219	missense	probably damaging	1.00
R9344:Vmn2r98	UTSW	17	19066515	missense	probably benign	0.14
R9467:Vmn2r98	UTSW	17	19067255	missense	probably benign	0.01
R9487:Vmn2r98	UTSW	17	19081234	missense	possibly damaging	0.78
R9753:Vmn2r98	UTSW	17	19065403	missense	probably benign	0.27
Z1177:Vmn2r98	UTSW	17	19065136	critical splice acceptor site	probably null
Z1177:Vmn2r98	UTSW	17	19067423	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CCAAAGCTATCACTGTGGTCCTTGC -3'
(R):5'- TGCTGTGCTGGAAGCCAAGATG -3'

Sequencing Primer
(F):5'- GCCTTTAAGATCAGTTTTCCAGG -3'
(R):5'- GAAGAACACCAGCATACTGAATG -3'

Posted On

2014-04-24