Mutagenetix > Incidental Mutation

Incidental Mutation 'R1643:Nedd4l'

173721

Institutional Source

Beutler Lab

Gene Symbol

Nedd4l

Ensembl Gene

ENSMUSG00000024589

Gene Name

neural precursor cell expressed, developmentally down-regulated gene 4-like

Synonyms

Nedd4-2, Nedd4b, 1300012C07Rik

MMRRC Submission

039679-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.245) question?

Stock #

R1643 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

64887705-65217831 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 65198641 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 636 (Y636C)

Ref Sequence

ENSEMBL: ENSMUSP00000153526 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000080418] [ENSMUST00000163516] [ENSMUST00000224347] [ENSMUST00000226058]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000080418
AA Change: Y636C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000079280
Gene: ENSMUSG00000024589
AA Change: Y636C

Domain	Start	End	E-Value	Type
PDB:3M7F\|B	1	64	2e-21	PDB
WW	73	105	2.32e-13	SMART
low complexity region	139	154	N/A	INTRINSIC
low complexity region	166	178	N/A	INTRINSIC
low complexity region	234	247	N/A	INTRINSIC
WW	266	298	2.08e-15	SMART
low complexity region	355	371	N/A	INTRINSIC
WW	378	410	4.1e-14	SMART
WW	429	461	1.53e-13	SMART
HECTc	518	854	3.04e-183	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000163516
AA Change: Y757C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000132838
Gene: ENSMUSG00000024589
AA Change: Y757C

Domain	Start	End	E-Value	Type
C2	21	124	1.76e-25	SMART
WW	194	226	2.32e-13	SMART
low complexity region	260	275	N/A	INTRINSIC
low complexity region	287	299	N/A	INTRINSIC
low complexity region	355	368	N/A	INTRINSIC
WW	387	419	2.08e-15	SMART
low complexity region	476	492	N/A	INTRINSIC
WW	499	531	4.1e-14	SMART
WW	550	582	1.53e-13	SMART
HECTc	639	975	3.04e-183	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000224347
AA Change: Y616C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224663

Predicted Effect

probably damaging
Transcript: ENSMUST00000226058
AA Change: Y636C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Meta Mutation Damage Score

0.6626

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.2%
20x: 92.5%

Validation Efficiency

99% (74/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Nedd4 family of HECT domain E3 ubiquitin ligases. HECT domain E3 ubiquitin ligases transfer ubiquitin from E2 ubiquitin-conjugating enzymes to protein substrates, thus targeting specific proteins for lysosomal degradation. The encoded protein mediates the ubiquitination of multiple target substrates and plays a critical role in epithelial sodium transport by regulating the cell surface expression of the epithelial sodium channel, ENaC. Single nucleotide polymorphisms in this gene may be associated with essential hypertension. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for a null mutation display salt sensitive hypertension and high salt diet induced cardiac hypertrophy. A spontaneous mutation results in overt diabetes insipidus. Mice homozygous for a knock-out allele exhibit neonatal lethality with primary atelectasis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700037C18Rik	T	A	16: 3,907,078	K45*	probably null	Het
Abcc1	T	A	16: 14,413,368	Y457N	probably damaging	Het
Actr3b	A	G	5: 25,812,011	D19G	probably damaging	Het
Adam39	T	C	8: 40,826,486	V638A	possibly damaging	Het
Adamts1	G	T	16: 85,796,817		probably benign	Het
AI661453	A	G	17: 47,467,866		probably benign	Het
Ank3	G	A	10: 69,884,802	S565N	probably benign	Het
Casd1	A	G	6: 4,621,243	E267G	probably benign	Het
Casr	T	C	16: 36,500,205	K527R	probably damaging	Het
Cep128	A	C	12: 91,325,532	S248A	probably damaging	Het
Clic4	A	G	4: 135,238,895	V50A	possibly damaging	Het
Cylc2	C	T	4: 51,225,173	A36V	probably benign	Het
Derl1	T	A	15: 57,878,559	M127L	probably benign	Het
Dnah6	A	G	6: 73,044,752	V3529A	possibly damaging	Het
Dock1	G	T	7: 135,098,779	L1089F	probably damaging	Het
Edil3	T	A	13: 89,289,576		probably null	Het
Ephb1	A	G	9: 101,996,825	V550A	probably damaging	Het
Fam129c	A	G	8: 71,600,164	D94G	probably benign	Het
Fcho2	G	A	13: 98,784,816	T187I	probably benign	Het
Gas6	T	C	8: 13,465,902		probably null	Het
Gdf7	T	C	12: 8,297,971	Y442C	probably damaging	Het
Gm11567	G	A	11: 99,879,797	G187E	unknown	Het
Gm11639	A	T	11: 104,698,978	T134S	probably benign	Het
Gm8674	T	C	13: 49,901,358		noncoding transcript	Het
Ift80	T	A	3: 68,916,157	I591F	probably benign	Het
Kcnn3	C	T	3: 89,520,497	S10L	unknown	Het
Keg1	A	G	19: 12,719,042	I197V	probably benign	Het
Klhdc9	A	G	1: 171,359,466		probably null	Het
Klhl11	A	G	11: 100,463,015	V660A	probably benign	Het
Lamc1	T	C	1: 153,258,072		probably benign	Het
Lrrc73	G	T	17: 46,255,340		probably null	Het
Lrriq1	G	A	10: 103,214,824	S689L	probably benign	Het
Magi2	A	G	5: 20,705,506		probably benign	Het
Meis1	A	G	11: 19,016,278	S32P	probably benign	Het
Mia2	A	G	12: 59,179,845		probably null	Het
Mlph	T	C	1: 90,941,734	L486P	probably damaging	Het
Myh10	A	G	11: 68,792,010	E1090G	probably damaging	Het
Mylk	T	C	16: 34,875,635	S247P	probably benign	Het
Naip2	C	T	13: 100,161,981	A516T	possibly damaging	Het
Ndufc1	T	C	3: 51,408,243	T25A	probably benign	Het
Nfib	A	T	4: 82,498,679	Y40N	probably damaging	Het
Nisch	T	C	14: 31,173,168	D1057G	probably damaging	Het
P3h2	T	C	16: 25,972,291	H475R	probably benign	Het
Pde6c	C	A	19: 38,161,958	T517K	possibly damaging	Het
Piezo2	T	C	18: 63,082,915	I994V	probably benign	Het
Pik3r4	A	G	9: 105,687,152	D1315G	possibly damaging	Het
Pip5k1c	T	G	10: 81,314,994	V46G	probably damaging	Het
Pole	A	G	5: 110,317,845	E1213G	probably damaging	Het
Prl7d1	T	C	13: 27,712,131	S88G	possibly damaging	Het
Prodh	T	A	16: 18,081,069	N72I	probably benign	Het
Prrc2a	G	A	17: 35,156,954	R907C	probably damaging	Het
Ptger2	T	A	14: 44,988,966	M1K	probably null	Het
Samd4b	G	C	7: 28,423,616	Q6E	probably damaging	Het
Sec24a	C	T	11: 51,704,385	R916H	probably benign	Het
Slc12a5	C	A	2: 164,994,027	D865E	probably benign	Het
Slc17a3	T	C	13: 23,857,198		probably benign	Het
Ssrp1	T	C	2: 85,041,185	V317A	possibly damaging	Het
Stim1	A	G	7: 102,386,100	D95G	possibly damaging	Het
Taok2	A	T	7: 126,875,938		probably benign	Het
Tcof1	T	G	18: 60,816,228	K1205T	possibly damaging	Het
Trim43c	C	T	9: 88,847,477	R325C	probably damaging	Het
Trub2	T	G	2: 29,777,936	T231P	probably damaging	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Uty	T	A	Y: 1,152,054	D724V	probably damaging	Het
Vmn2r98	A	G	17: 19,080,908	D724G	probably damaging	Het
Wdfy3	A	G	5: 101,875,915	I2442T	possibly damaging	Het
Wdfy4	T	C	14: 33,073,585		probably null	Het
Zfp280b	A	G	10: 76,039,610	H441R	probably damaging	Het
Zfp60	A	T	7: 27,736,975	Q7L	probably damaging	Het
Zzef1	T	C	11: 72,826,202	L406S	probably damaging	Het

Other mutations in Nedd4l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00501:Nedd4l	APN	18	65208092	missense	probably damaging	1.00
IGL00931:Nedd4l	APN	18	65172399	missense	possibly damaging	0.57
IGL02306:Nedd4l	APN	18	65172954	missense	possibly damaging	0.64
IGL02363:Nedd4l	APN	18	65208045	splice site	probably benign
IGL02440:Nedd4l	APN	18	65163173	critical splice donor site	probably null
IGL02444:Nedd4l	APN	18	65203957	splice site	probably benign
IGL02700:Nedd4l	APN	18	65209680	missense	probably damaging	1.00
IGL02943:Nedd4l	APN	18	65161652	critical splice donor site	probably null
IGL02999:Nedd4l	APN	18	65198707	missense	probably damaging	1.00
IGL03135:Nedd4l	APN	18	65205670	missense	probably damaging	1.00
IGL03373:Nedd4l	APN	18	65181320	splice site	probably benign
R0036:Nedd4l	UTSW	18	65051123	intron	probably benign
R0396:Nedd4l	UTSW	18	65161654	splice site	probably benign
R0472:Nedd4l	UTSW	18	65208461	missense	probably damaging	1.00
R0494:Nedd4l	UTSW	18	65173021	missense	possibly damaging	0.69
R0513:Nedd4l	UTSW	18	65195185	splice site	probably benign
R0609:Nedd4l	UTSW	18	65208461	missense	probably damaging	1.00
R0631:Nedd4l	UTSW	18	65208503	splice site	probably benign
R1077:Nedd4l	UTSW	18	65167499	splice site	probably benign
R1722:Nedd4l	UTSW	18	65157939	missense	probably damaging	1.00
R1806:Nedd4l	UTSW	18	65212791	missense	probably damaging	1.00
R1921:Nedd4l	UTSW	18	65167575	critical splice donor site	probably null
R1986:Nedd4l	UTSW	18	65143803	missense	probably damaging	1.00
R2070:Nedd4l	UTSW	18	65212820	missense	probably damaging	1.00
R2151:Nedd4l	UTSW	18	65210330	missense	probably damaging	1.00
R2152:Nedd4l	UTSW	18	65210330	missense	probably damaging	1.00
R2154:Nedd4l	UTSW	18	65210330	missense	probably damaging	1.00
R2358:Nedd4l	UTSW	18	65209719	missense	possibly damaging	0.51
R2680:Nedd4l	UTSW	18	65163130	missense	possibly damaging	0.85
R3082:Nedd4l	UTSW	18	65178978	missense	probably benign	0.00
R3500:Nedd4l	UTSW	18	65212860	missense	probably damaging	1.00
R3711:Nedd4l	UTSW	18	65209719	missense	possibly damaging	0.51
R3712:Nedd4l	UTSW	18	65209719	missense	possibly damaging	0.51
R3874:Nedd4l	UTSW	18	65167535	missense	probably benign
R4435:Nedd4l	UTSW	18	65212825	missense	possibly damaging	0.84
R4698:Nedd4l	UTSW	18	65203880	missense	probably damaging	1.00
R4757:Nedd4l	UTSW	18	65165605	missense	probably damaging	0.98
R4783:Nedd4l	UTSW	18	65172927	missense	probably damaging	0.99
R4790:Nedd4l	UTSW	18	65203945	missense	possibly damaging	0.94
R4980:Nedd4l	UTSW	18	65080060	nonsense	probably null
R5106:Nedd4l	UTSW	18	65193305	missense	probably damaging	1.00
R5122:Nedd4l	UTSW	18	65191447	missense	probably damaging	1.00
R5605:Nedd4l	UTSW	18	65174244	critical splice donor site	probably null
R6465:Nedd4l	UTSW	18	65155264	missense	probably benign	0.06
R6479:Nedd4l	UTSW	18	65209681	missense	probably damaging	1.00
R6622:Nedd4l	UTSW	18	65174234	missense	probably damaging	0.99
R6773:Nedd4l	UTSW	18	65167551	missense	probably benign	0.36
R7065:Nedd4l	UTSW	18	65195969	missense	probably benign	0.04
R7068:Nedd4l	UTSW	18	65205651	missense	probably damaging	1.00
R7193:Nedd4l	UTSW	18	64997370	missense	probably damaging	1.00
R7496:Nedd4l	UTSW	18	65080018	missense	possibly damaging	0.94
R7903:Nedd4l	UTSW	18	65186367	missense	probably damaging	1.00
R8123:Nedd4l	UTSW	18	65074774	missense	probably damaging	1.00
R8185:Nedd4l	UTSW	18	65209698	missense	probably damaging	1.00
R8282:Nedd4l	UTSW	18	65191489	missense	probably damaging	0.98
R8440:Nedd4l	UTSW	18	64889055	splice site	probably null
R8499:Nedd4l	UTSW	18	65209657	missense	probably damaging	0.98
R8557:Nedd4l	UTSW	18	65203915	missense	probably benign	0.00
R8801:Nedd4l	UTSW	18	65155275	missense	probably damaging	1.00
R8896:Nedd4l	UTSW	18	65165617	missense	probably benign
R9025:Nedd4l	UTSW	18	65178924	missense	probably damaging	0.98
R9040:Nedd4l	UTSW	18	65209663	missense	probably damaging	0.99
R9482:Nedd4l	UTSW	18	64887960	unclassified	probably benign
R9498:Nedd4l	UTSW	18	65161652	critical splice donor site	probably null
R9599:Nedd4l	UTSW	18	65210329	missense	probably damaging	1.00
RF013:Nedd4l	UTSW	18	65209680	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAGCAGGTGGCCTTCACAGTAGAG -3'
(R):5'- AGCCATGCTGTCCTATAGTCCACG -3'

Sequencing Primer
(F):5'- cacacatacacacacacacac -3'
(R):5'- TGTCCTATAGTCCACGGCAAAG -3'

Posted On

2014-04-24