Mutagenetix > Incidental Mutation

Incidental Mutation 'R1644:A830018L16Rik'

173726

Institutional Source

Beutler Lab

Gene Symbol

A830018L16Rik

Ensembl Gene

ENSMUSG00000057715

Gene Name

RIKEN cDNA A830018L16 gene

Synonyms

MMRRC Submission

039680-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.060) question?

Stock #

R1644 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

11414105-11975901 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to T at 11414590 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Stop codon at position 8 (R8*)

Ref Sequence

ENSEMBL: ENSMUSP00000137287 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048613] [ENSMUST00000135014] [ENSMUST00000137824] [ENSMUST00000141512] [ENSMUST00000171690] [ENSMUST00000179089]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000048613
AA Change: R8*

SMART Domains

Protein: ENSMUSP00000043857
Gene: ENSMUSG00000057715
AA Change: R8*

Domain	Start	End	E-Value	Type
low complexity region	58	73	N/A	INTRINSIC
low complexity region	213	223	N/A	INTRINSIC
low complexity region	233	248	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000135014
AA Change: R8*

SMART Domains

Protein: ENSMUSP00000119143
Gene: ENSMUSG00000057715
AA Change: R8*

Domain	Start	End	E-Value	Type
low complexity region	58	73	N/A	INTRINSIC
low complexity region	213	223	N/A	INTRINSIC
low complexity region	233	248	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000137824
AA Change: R8*

SMART Domains

Protein: ENSMUSP00000117421
Gene: ENSMUSG00000057715
AA Change: R8*

Domain	Start	End	E-Value	Type
low complexity region	58	73	N/A	INTRINSIC
low complexity region	213	223	N/A	INTRINSIC
low complexity region	233	248	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000141512
AA Change: R8*

SMART Domains

Protein: ENSMUSP00000139635
Gene: ENSMUSG00000057715
AA Change: R8*

Domain	Start	End	E-Value	Type
low complexity region	58	73	N/A	INTRINSIC
low complexity region	213	223	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142117

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150870

Predicted Effect

probably null
Transcript: ENSMUST00000171690
AA Change: R8*

SMART Domains

Protein: ENSMUSP00000132334
Gene: ENSMUSG00000057715
AA Change: R8*

Domain	Start	End	E-Value	Type
low complexity region	58	73	N/A	INTRINSIC
low complexity region	213	223	N/A	INTRINSIC
low complexity region	233	248	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000179089
AA Change: R8*

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000194502

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.0%
20x: 91.6%

Validation Efficiency

98% (62/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is related to the cyclic AMP dependent protein kinase regulators. Naturally occurring mutations in this gene are associated with an increased risk for severe toxicities, such as diarrhea and neutropenia, in patients undergoing chemotherapeutic treatment. [provided by RefSeq, Mar 2017]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acacb	A	T	5: 114,195,285	H490L	probably damaging	Het
Ace	C	A	11: 105,985,106	H417N	probably damaging	Het
Adamtsl3	A	G	7: 82,450,090	N151D	possibly damaging	Het
Agap1	A	G	1: 89,663,730	N114S	probably damaging	Het
Arap3	A	T	18: 37,984,245	V926D	probably damaging	Het
Arhgap12	A	T	18: 6,112,340	I8N	probably benign	Het
Arhgef17	A	T	7: 100,929,504	F746I	probably damaging	Het
Atp6v0a1	T	C	11: 101,038,786	S471P	possibly damaging	Het
Bdp1	A	G	13: 100,060,940	V979A	probably benign	Het
Ccdc88c	C	A	12: 100,913,474	R1789L	probably damaging	Het
Cckar	A	T	5: 53,699,873	N327K	probably benign	Het
Cfap65	T	C	1: 74,917,175	T1082A	probably damaging	Het
Clcn7	T	A	17: 25,159,698	I719N	probably damaging	Het
Col27a1	C	G	4: 63,328,631		probably benign	Het
Cspp1	C	T	1: 10,126,438	T179I	probably damaging	Het
Dnah1	C	T	14: 31,302,292		probably benign	Het
Dnah6	A	G	6: 73,155,296	V1141A	probably benign	Het
Dusp4	A	G	8: 34,818,479	Y298C	probably damaging	Het
Efhc1	C	A	1: 20,967,401	Y267*	probably null	Het
Eif2s1	T	A	12: 78,866,521		probably null	Het
Epo	A	G	5: 137,483,155	V169A	possibly damaging	Het
Esr1	A	T	10: 5,001,380	Y586F	probably benign	Het
Fat2	T	C	11: 55,287,783	T1484A	possibly damaging	Het
Fat2	T	C	11: 55,296,181	T1280A	possibly damaging	Het
Gm5828	T	C	1: 16,769,261		noncoding transcript	Het
Idh3b	T	C	2: 130,281,510	I187V	possibly damaging	Het
Kif13a	A	C	13: 46,793,922	V862G	probably benign	Het
Kndc1	A	G	7: 139,930,756	D1327G	probably damaging	Het
Mfsd9	T	A	1: 40,773,798	R452S	probably benign	Het
Myh15	C	T	16: 49,132,203	R879C	probably benign	Het
Naip2	T	C	13: 100,182,929	R260G	possibly damaging	Het
Npat	T	G	9: 53,570,172	L1060R	probably damaging	Het
Olfr1211	A	T	2: 88,929,387	D309E	probably benign	Het
Olfr1261	A	T	2: 89,993,953	T187S	possibly damaging	Het
Olfr169	T	A	16: 19,566,406	H159L	probably benign	Het
Olfr523	T	C	7: 140,176,648	V176A	probably benign	Het
Olfr667	A	C	7: 104,916,808	F163V	probably benign	Het
Pld5	T	C	1: 175,975,626	T296A	possibly damaging	Het
Polq	C	T	16: 37,060,264	A651V	probably damaging	Het
Polr3a	G	A	14: 24,470,624	P607S	probably damaging	Het
Ranbp9	G	A	13: 43,412,539	R424C	probably damaging	Het
Rsl1	G	A	13: 67,177,165		probably benign	Het
Sema4c	A	G	1: 36,550,804	S490P	probably damaging	Het
Setd3	A	T	12: 108,113,344	L300Q	possibly damaging	Het
Slc15a3	T	C	19: 10,857,231	I492T	possibly damaging	Het
Stag1	T	C	9: 100,880,900		probably benign	Het
Tgm4	A	G	9: 123,051,416	Y294C	probably damaging	Het
Tm9sf1	A	G	14: 55,641,300	S212P	probably benign	Het
Tmcc1	A	G	6: 116,133,865	S156P	probably damaging	Het
Vmn1r184	A	C	7: 26,267,245	M139L	probably benign	Het
Vmn1r209	A	C	13: 22,806,482	F13V	possibly damaging	Het
Xkr5	T	C	8: 18,934,125	E467G	probably benign	Het
Zdbf2	C	T	1: 63,308,972	S2170L	possibly damaging	Het
Zfp277	G	T	12: 40,329,610		probably null	Het
Zfp62	T	C	11: 49,215,769	I229T	probably damaging	Het
Zfp810	A	G	9: 22,279,028	S195P	possibly damaging	Het
Zfp94	G	A	7: 24,311,502		probably benign	Het

Other mutations in A830018L16Rik

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00426:A830018L16Rik	APN	1	11748054	missense	probably damaging	0.98
IGL01916:A830018L16Rik	APN	1	11748107	splice site	probably benign
IGL02040:A830018L16Rik	APN	1	11933598	intron	probably benign
IGL02432:A830018L16Rik	APN	1	11748079	missense	probably damaging	1.00
IGL02693:A830018L16Rik	APN	1	11596282	missense	probably damaging	1.00
IGL02736:A830018L16Rik	APN	1	11972051	missense	probably benign	0.02
IGL03293:A830018L16Rik	APN	1	11545151	splice site	probably null
IGL02835:A830018L16Rik	UTSW	1	11972055	missense	possibly damaging	0.54
R1203:A830018L16Rik	UTSW	1	11518594	missense	probably damaging	1.00
R1216:A830018L16Rik	UTSW	1	11798492	missense	probably damaging	0.99
R1548:A830018L16Rik	UTSW	1	11518594	missense	probably damaging	1.00
R1855:A830018L16Rik	UTSW	1	11747971	missense	probably damaging	1.00
R1858:A830018L16Rik	UTSW	1	11974953	missense	unknown
R2265:A830018L16Rik	UTSW	1	11972104	critical splice donor site	probably null
R2296:A830018L16Rik	UTSW	1	11512051	missense	possibly damaging	0.94
R2484:A830018L16Rik	UTSW	1	11596302	missense	probably damaging	1.00
R3730:A830018L16Rik	UTSW	1	11545226	missense	probably damaging	1.00
R3752:A830018L16Rik	UTSW	1	11518680	missense	probably damaging	1.00
R3861:A830018L16Rik	UTSW	1	11588554	splice site	probably benign
R4305:A830018L16Rik	UTSW	1	11972076	nonsense	probably null
R4306:A830018L16Rik	UTSW	1	11972076	nonsense	probably null
R4307:A830018L16Rik	UTSW	1	11972076	nonsense	probably null
R4558:A830018L16Rik	UTSW	1	11972076	nonsense	probably null
R4598:A830018L16Rik	UTSW	1	11747964	critical splice acceptor site	probably null
R4652:A830018L16Rik	UTSW	1	11537342	intron	probably benign
R5492:A830018L16Rik	UTSW	1	11545207	missense	probably damaging	0.99
R5493:A830018L16Rik	UTSW	1	11545207	missense	probably damaging	0.99
R5802:A830018L16Rik	UTSW	1	11950964	missense	probably damaging	1.00
R6007:A830018L16Rik	UTSW	1	11511916	critical splice acceptor site	probably null
R6082:A830018L16Rik	UTSW	1	11798528	missense	probably benign	0.04
R6376:A830018L16Rik	UTSW	1	11798494	missense	probably damaging	0.98
R6453:A830018L16Rik	UTSW	1	11798558	missense	possibly damaging	0.91
R6757:A830018L16Rik	UTSW	1	11596334	makesense	probably null
R6833:A830018L16Rik	UTSW	1	11588509	missense	probably damaging	1.00
R7163:A830018L16Rik	UTSW	1	11414624	missense	probably damaging	0.96
R7272:A830018L16Rik	UTSW	1	11588471	missense	probably damaging	0.97
R7566:A830018L16Rik	UTSW	1	11951028	missense	probably damaging	1.00
R7665:A830018L16Rik	UTSW	1	11972099	missense	probably damaging	0.96
R8004:A830018L16Rik	UTSW	1	11951062	splice site	probably benign
R8754:A830018L16Rik	UTSW	1	11545248	missense	probably benign	0.33
R8944:A830018L16Rik	UTSW	1	11414482	unclassified	probably benign
R8993:A830018L16Rik	UTSW	1	11545267	nonsense	probably null
R8997:A830018L16Rik	UTSW	1	11545267	nonsense	probably null
R9098:A830018L16Rik	UTSW	1	11562987	missense	probably damaging	1.00
R9640:A830018L16Rik	UTSW	1	11950976	missense	probably damaging	0.98
R9704:A830018L16Rik	UTSW	1	11518689	missense	probably damaging	1.00
R9705:A830018L16Rik	UTSW	1	11518689	missense	probably damaging	1.00
Z1176:A830018L16Rik	UTSW	1	11518625	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- GATGCGATGTAGTTCTCTCCTTGCC -3'
(R):5'- AGAACACCTAGTGGGACAGTCCTC -3'

Sequencing Primer
(F):5'- CTGAGTTGGTAGAGCCTCGC -3'
(R):5'- TCAAAGAGAGCGGGACCATT -3'

Posted On

2014-04-24