Incidental Mutation 'R1644:A830018L16Rik'
ID 173726
Institutional Source Beutler Lab
Gene Symbol A830018L16Rik
Ensembl Gene ENSMUSG00000057715
Gene Name RIKEN cDNA A830018L16 gene
Synonyms
MMRRC Submission 039680-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.054) question?
Stock # R1644 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 11484329-12046125 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 11484814 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Stop codon at position 8 (R8*)
Ref Sequence ENSEMBL: ENSMUSP00000137287 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048613] [ENSMUST00000135014] [ENSMUST00000137824] [ENSMUST00000141512] [ENSMUST00000171690] [ENSMUST00000179089]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000048613
AA Change: R8*
SMART Domains Protein: ENSMUSP00000043857
Gene: ENSMUSG00000057715
AA Change: R8*

DomainStartEndE-ValueType
low complexity region 58 73 N/A INTRINSIC
low complexity region 213 223 N/A INTRINSIC
low complexity region 233 248 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000135014
AA Change: R8*
SMART Domains Protein: ENSMUSP00000119143
Gene: ENSMUSG00000057715
AA Change: R8*

DomainStartEndE-ValueType
low complexity region 58 73 N/A INTRINSIC
low complexity region 213 223 N/A INTRINSIC
low complexity region 233 248 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000137824
AA Change: R8*
SMART Domains Protein: ENSMUSP00000117421
Gene: ENSMUSG00000057715
AA Change: R8*

DomainStartEndE-ValueType
low complexity region 58 73 N/A INTRINSIC
low complexity region 213 223 N/A INTRINSIC
low complexity region 233 248 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000141512
AA Change: R8*
SMART Domains Protein: ENSMUSP00000139635
Gene: ENSMUSG00000057715
AA Change: R8*

DomainStartEndE-ValueType
low complexity region 58 73 N/A INTRINSIC
low complexity region 213 223 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142117
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150870
Predicted Effect probably null
Transcript: ENSMUST00000171690
AA Change: R8*
SMART Domains Protein: ENSMUSP00000132334
Gene: ENSMUSG00000057715
AA Change: R8*

DomainStartEndE-ValueType
low complexity region 58 73 N/A INTRINSIC
low complexity region 213 223 N/A INTRINSIC
low complexity region 233 248 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000179089
AA Change: R8*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194502
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.6%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is related to the cyclic AMP dependent protein kinase regulators. Naturally occurring mutations in this gene are associated with an increased risk for severe toxicities, such as diarrhea and neutropenia, in patients undergoing chemotherapeutic treatment. [provided by RefSeq, Mar 2017]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb A T 5: 114,333,346 (GRCm39) H490L probably damaging Het
Ace C A 11: 105,875,932 (GRCm39) H417N probably damaging Het
Adamtsl3 A G 7: 82,099,298 (GRCm39) N151D possibly damaging Het
Agap1 A G 1: 89,591,452 (GRCm39) N114S probably damaging Het
Arap3 A T 18: 38,117,298 (GRCm39) V926D probably damaging Het
Arhgap12 A T 18: 6,112,340 (GRCm39) I8N probably benign Het
Arhgef17 A T 7: 100,578,711 (GRCm39) F746I probably damaging Het
Atp6v0a1 T C 11: 100,929,612 (GRCm39) S471P possibly damaging Het
Bdp1 A G 13: 100,197,448 (GRCm39) V979A probably benign Het
Ccdc88c C A 12: 100,879,733 (GRCm39) R1789L probably damaging Het
Cckar A T 5: 53,857,215 (GRCm39) N327K probably benign Het
Cfap65 T C 1: 74,956,334 (GRCm39) T1082A probably damaging Het
Clcn7 T A 17: 25,378,672 (GRCm39) I719N probably damaging Het
Col27a1 C G 4: 63,246,868 (GRCm39) probably benign Het
Cspp1 C T 1: 10,196,663 (GRCm39) T179I probably damaging Het
Dnah1 C T 14: 31,024,249 (GRCm39) probably benign Het
Dnah6 A G 6: 73,132,279 (GRCm39) V1141A probably benign Het
Dusp4 A G 8: 35,285,633 (GRCm39) Y298C probably damaging Het
Efhc1 C A 1: 21,037,625 (GRCm39) Y267* probably null Het
Eif2s1 T A 12: 78,913,295 (GRCm39) probably null Het
Epo A G 5: 137,481,417 (GRCm39) V169A possibly damaging Het
Esr1 A T 10: 4,951,380 (GRCm39) Y586F probably benign Het
Fat2 T C 11: 55,178,609 (GRCm39) T1484A possibly damaging Het
Fat2 T C 11: 55,187,007 (GRCm39) T1280A possibly damaging Het
Gm5828 T C 1: 16,839,485 (GRCm39) noncoding transcript Het
Idh3b T C 2: 130,123,430 (GRCm39) I187V possibly damaging Het
Kif13a A C 13: 46,947,398 (GRCm39) V862G probably benign Het
Kndc1 A G 7: 139,510,669 (GRCm39) D1327G probably damaging Het
Mfsd9 T A 1: 40,812,958 (GRCm39) R452S probably benign Het
Myh15 C T 16: 48,952,566 (GRCm39) R879C probably benign Het
Naip2 T C 13: 100,319,437 (GRCm39) R260G possibly damaging Het
Npat T G 9: 53,481,472 (GRCm39) L1060R probably damaging Het
Or2aj4 T A 16: 19,385,156 (GRCm39) H159L probably benign Het
Or4c126 A T 2: 89,824,297 (GRCm39) T187S possibly damaging Het
Or4c15 A T 2: 88,759,731 (GRCm39) D309E probably benign Het
Or52n2b A C 7: 104,566,015 (GRCm39) F163V probably benign Het
Or6f2 T C 7: 139,756,561 (GRCm39) V176A probably benign Het
Pld5 T C 1: 175,803,192 (GRCm39) T296A possibly damaging Het
Polq C T 16: 36,880,626 (GRCm39) A651V probably damaging Het
Polr3a G A 14: 24,520,692 (GRCm39) P607S probably damaging Het
Ranbp9 G A 13: 43,566,015 (GRCm39) R424C probably damaging Het
Rsl1 G A 13: 67,325,229 (GRCm39) probably benign Het
Sema4c A G 1: 36,589,885 (GRCm39) S490P probably damaging Het
Setd3 A T 12: 108,079,603 (GRCm39) L300Q possibly damaging Het
Slc15a3 T C 19: 10,834,595 (GRCm39) I492T possibly damaging Het
Stag1 T C 9: 100,762,953 (GRCm39) probably benign Het
Tgm4 A G 9: 122,880,481 (GRCm39) Y294C probably damaging Het
Tm9sf1 A G 14: 55,878,757 (GRCm39) S212P probably benign Het
Tmcc1 A G 6: 116,110,826 (GRCm39) S156P probably damaging Het
Vmn1r184 A C 7: 25,966,670 (GRCm39) M139L probably benign Het
Vmn1r209 A C 13: 22,990,652 (GRCm39) F13V possibly damaging Het
Xkr5 T C 8: 18,984,141 (GRCm39) E467G probably benign Het
Zdbf2 C T 1: 63,348,131 (GRCm39) S2170L possibly damaging Het
Zfp277 G T 12: 40,379,609 (GRCm39) probably null Het
Zfp62 T C 11: 49,106,596 (GRCm39) I229T probably damaging Het
Zfp810 A G 9: 22,190,324 (GRCm39) S195P possibly damaging Het
Zfp94 G A 7: 24,010,927 (GRCm39) probably benign Het
Other mutations in A830018L16Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00426:A830018L16Rik APN 1 11,818,278 (GRCm39) missense probably damaging 0.98
IGL01916:A830018L16Rik APN 1 11,818,331 (GRCm39) splice site probably benign
IGL02040:A830018L16Rik APN 1 12,003,822 (GRCm39) intron probably benign
IGL02432:A830018L16Rik APN 1 11,818,303 (GRCm39) missense probably damaging 1.00
IGL02693:A830018L16Rik APN 1 11,666,506 (GRCm39) missense probably damaging 1.00
IGL02736:A830018L16Rik APN 1 12,042,275 (GRCm39) missense probably benign 0.02
IGL03293:A830018L16Rik APN 1 11,615,375 (GRCm39) splice site probably null
IGL02835:A830018L16Rik UTSW 1 12,042,279 (GRCm39) missense possibly damaging 0.54
R1203:A830018L16Rik UTSW 1 11,588,818 (GRCm39) missense probably damaging 1.00
R1216:A830018L16Rik UTSW 1 11,868,716 (GRCm39) missense probably damaging 0.99
R1548:A830018L16Rik UTSW 1 11,588,818 (GRCm39) missense probably damaging 1.00
R1855:A830018L16Rik UTSW 1 11,818,195 (GRCm39) missense probably damaging 1.00
R1858:A830018L16Rik UTSW 1 12,045,177 (GRCm39) missense unknown
R2265:A830018L16Rik UTSW 1 12,042,328 (GRCm39) critical splice donor site probably null
R2296:A830018L16Rik UTSW 1 11,582,275 (GRCm39) missense possibly damaging 0.94
R2484:A830018L16Rik UTSW 1 11,666,526 (GRCm39) missense probably damaging 1.00
R3730:A830018L16Rik UTSW 1 11,615,450 (GRCm39) missense probably damaging 1.00
R3752:A830018L16Rik UTSW 1 11,588,904 (GRCm39) missense probably damaging 1.00
R3861:A830018L16Rik UTSW 1 11,658,778 (GRCm39) splice site probably benign
R4305:A830018L16Rik UTSW 1 12,042,300 (GRCm39) nonsense probably null
R4306:A830018L16Rik UTSW 1 12,042,300 (GRCm39) nonsense probably null
R4307:A830018L16Rik UTSW 1 12,042,300 (GRCm39) nonsense probably null
R4558:A830018L16Rik UTSW 1 12,042,300 (GRCm39) nonsense probably null
R4598:A830018L16Rik UTSW 1 11,818,188 (GRCm39) critical splice acceptor site probably null
R4652:A830018L16Rik UTSW 1 11,607,566 (GRCm39) intron probably benign
R5492:A830018L16Rik UTSW 1 11,615,431 (GRCm39) missense probably damaging 0.99
R5493:A830018L16Rik UTSW 1 11,615,431 (GRCm39) missense probably damaging 0.99
R5802:A830018L16Rik UTSW 1 12,021,188 (GRCm39) missense probably damaging 1.00
R6007:A830018L16Rik UTSW 1 11,582,140 (GRCm39) critical splice acceptor site probably null
R6082:A830018L16Rik UTSW 1 11,868,752 (GRCm39) missense probably benign 0.04
R6376:A830018L16Rik UTSW 1 11,868,718 (GRCm39) missense probably damaging 0.98
R6453:A830018L16Rik UTSW 1 11,868,782 (GRCm39) missense possibly damaging 0.91
R6757:A830018L16Rik UTSW 1 11,666,558 (GRCm39) makesense probably null
R6833:A830018L16Rik UTSW 1 11,658,733 (GRCm39) missense probably damaging 1.00
R7163:A830018L16Rik UTSW 1 11,484,848 (GRCm39) missense probably damaging 0.96
R7272:A830018L16Rik UTSW 1 11,658,695 (GRCm39) missense probably damaging 0.97
R7566:A830018L16Rik UTSW 1 12,021,252 (GRCm39) missense probably damaging 1.00
R7665:A830018L16Rik UTSW 1 12,042,323 (GRCm39) missense probably damaging 0.96
R8004:A830018L16Rik UTSW 1 12,021,286 (GRCm39) splice site probably benign
R8754:A830018L16Rik UTSW 1 11,615,472 (GRCm39) missense probably benign 0.33
R8944:A830018L16Rik UTSW 1 11,484,706 (GRCm39) unclassified probably benign
R8993:A830018L16Rik UTSW 1 11,615,491 (GRCm39) nonsense probably null
R8997:A830018L16Rik UTSW 1 11,615,491 (GRCm39) nonsense probably null
R9098:A830018L16Rik UTSW 1 11,633,211 (GRCm39) missense probably damaging 1.00
R9640:A830018L16Rik UTSW 1 12,021,200 (GRCm39) missense probably damaging 0.98
R9704:A830018L16Rik UTSW 1 11,588,913 (GRCm39) missense probably damaging 1.00
R9705:A830018L16Rik UTSW 1 11,588,913 (GRCm39) missense probably damaging 1.00
Z1176:A830018L16Rik UTSW 1 11,588,849 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GATGCGATGTAGTTCTCTCCTTGCC -3'
(R):5'- AGAACACCTAGTGGGACAGTCCTC -3'

Sequencing Primer
(F):5'- CTGAGTTGGTAGAGCCTCGC -3'
(R):5'- TCAAAGAGAGCGGGACCATT -3'
Posted On 2014-04-24