Incidental Mutation 'R1644:Sema4c'
ID 173729
Institutional Source Beutler Lab
Gene Symbol Sema4c
Ensembl Gene ENSMUSG00000026121
Gene Name sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4C
Synonyms M-Sema F, Semacl1, Semaf, Semai, Semacl1
MMRRC Submission 039680-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1644 (G1)
Quality Score 200
Status Validated
Chromosome 1
Chromosomal Location 36587720-36597430 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 36589885 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 490 (S490P)
Ref Sequence ENSEMBL: ENSMUSP00000141527 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001172] [ENSMUST00000114991] [ENSMUST00000191642] [ENSMUST00000191677] [ENSMUST00000193382] [ENSMUST00000194894] [ENSMUST00000195620] [ENSMUST00000207843]
AlphaFold Q64151
Predicted Effect probably benign
Transcript: ENSMUST00000001172
SMART Domains Protein: ENSMUSP00000001172
Gene: ENSMUSG00000079610

DomainStartEndE-ValueType
ANK 30 59 8.77e2 SMART
ANK 63 92 1.08e-5 SMART
ANK 96 127 1.27e-2 SMART
ANK 129 158 5.62e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114990
AA Change: S490P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110641
Gene: ENSMUSG00000026121
AA Change: S490P

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Sema 53 481 2.54e-183 SMART
PSI 499 552 4.52e-11 SMART
IG 563 647 1.77e-4 SMART
transmembrane domain 665 687 N/A INTRINSIC
low complexity region 754 774 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114991
AA Change: S490P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110643
Gene: ENSMUSG00000026121
AA Change: S490P

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Sema 53 481 2.54e-183 SMART
PSI 499 552 4.52e-11 SMART
IG 563 647 1.77e-4 SMART
transmembrane domain 665 687 N/A INTRINSIC
low complexity region 754 774 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000191642
AA Change: S490P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142284
Gene: ENSMUSG00000026121
AA Change: S490P

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Sema 53 481 2.54e-183 SMART
PSI 499 552 4.52e-11 SMART
IG 563 647 1.77e-4 SMART
transmembrane domain 665 687 N/A INTRINSIC
low complexity region 754 774 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000191677
AA Change: S490P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141263
Gene: ENSMUSG00000026121
AA Change: S490P

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Sema 53 481 2.54e-183 SMART
PSI 499 552 4.52e-11 SMART
IG 563 647 1.77e-4 SMART
transmembrane domain 665 687 N/A INTRINSIC
low complexity region 754 774 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191785
Predicted Effect probably benign
Transcript: ENSMUST00000193382
Predicted Effect probably benign
Transcript: ENSMUST00000194894
SMART Domains Protein: ENSMUSP00000141712
Gene: ENSMUSG00000079610

DomainStartEndE-ValueType
ANK 30 59 5.6e0 SMART
ANK 63 92 7.1e-8 SMART
ANK 96 127 8.2e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195160
Predicted Effect probably damaging
Transcript: ENSMUST00000195620
AA Change: S490P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141527
Gene: ENSMUSG00000026121
AA Change: S490P

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Sema 53 481 2.54e-183 SMART
PSI 499 552 4.52e-11 SMART
IG 563 647 1.77e-4 SMART
transmembrane domain 665 687 N/A INTRINSIC
low complexity region 754 774 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000207843
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208269
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208690
Meta Mutation Damage Score 0.4341 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.6%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: This gene encodes a member of the semaphorin family of proteins that have diverse functions in neuronal development, heart morphogenesis, vascular growth, tumor progression and immune cell regulation. Lack of the encoded protein in some mice causes exencephaly resulting in neonatal lethality. Mice that bypass exencephaly show no obvious behavioral defects but display distinct pigmentation defects. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for a targeted mutation exhibit exencephaly, neonatal lethality, and abnormal cerebellum morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik C T 1: 11,484,814 (GRCm39) R8* probably null Het
Acacb A T 5: 114,333,346 (GRCm39) H490L probably damaging Het
Ace C A 11: 105,875,932 (GRCm39) H417N probably damaging Het
Adamtsl3 A G 7: 82,099,298 (GRCm39) N151D possibly damaging Het
Agap1 A G 1: 89,591,452 (GRCm39) N114S probably damaging Het
Arap3 A T 18: 38,117,298 (GRCm39) V926D probably damaging Het
Arhgap12 A T 18: 6,112,340 (GRCm39) I8N probably benign Het
Arhgef17 A T 7: 100,578,711 (GRCm39) F746I probably damaging Het
Atp6v0a1 T C 11: 100,929,612 (GRCm39) S471P possibly damaging Het
Bdp1 A G 13: 100,197,448 (GRCm39) V979A probably benign Het
Ccdc88c C A 12: 100,879,733 (GRCm39) R1789L probably damaging Het
Cckar A T 5: 53,857,215 (GRCm39) N327K probably benign Het
Cfap65 T C 1: 74,956,334 (GRCm39) T1082A probably damaging Het
Clcn7 T A 17: 25,378,672 (GRCm39) I719N probably damaging Het
Col27a1 C G 4: 63,246,868 (GRCm39) probably benign Het
Cspp1 C T 1: 10,196,663 (GRCm39) T179I probably damaging Het
Dnah1 C T 14: 31,024,249 (GRCm39) probably benign Het
Dnah6 A G 6: 73,132,279 (GRCm39) V1141A probably benign Het
Dusp4 A G 8: 35,285,633 (GRCm39) Y298C probably damaging Het
Efhc1 C A 1: 21,037,625 (GRCm39) Y267* probably null Het
Eif2s1 T A 12: 78,913,295 (GRCm39) probably null Het
Epo A G 5: 137,481,417 (GRCm39) V169A possibly damaging Het
Esr1 A T 10: 4,951,380 (GRCm39) Y586F probably benign Het
Fat2 T C 11: 55,178,609 (GRCm39) T1484A possibly damaging Het
Fat2 T C 11: 55,187,007 (GRCm39) T1280A possibly damaging Het
Gm5828 T C 1: 16,839,485 (GRCm39) noncoding transcript Het
Idh3b T C 2: 130,123,430 (GRCm39) I187V possibly damaging Het
Kif13a A C 13: 46,947,398 (GRCm39) V862G probably benign Het
Kndc1 A G 7: 139,510,669 (GRCm39) D1327G probably damaging Het
Mfsd9 T A 1: 40,812,958 (GRCm39) R452S probably benign Het
Myh15 C T 16: 48,952,566 (GRCm39) R879C probably benign Het
Naip2 T C 13: 100,319,437 (GRCm39) R260G possibly damaging Het
Npat T G 9: 53,481,472 (GRCm39) L1060R probably damaging Het
Or2aj4 T A 16: 19,385,156 (GRCm39) H159L probably benign Het
Or4c126 A T 2: 89,824,297 (GRCm39) T187S possibly damaging Het
Or4c15 A T 2: 88,759,731 (GRCm39) D309E probably benign Het
Or52n2b A C 7: 104,566,015 (GRCm39) F163V probably benign Het
Or6f2 T C 7: 139,756,561 (GRCm39) V176A probably benign Het
Pld5 T C 1: 175,803,192 (GRCm39) T296A possibly damaging Het
Polq C T 16: 36,880,626 (GRCm39) A651V probably damaging Het
Polr3a G A 14: 24,520,692 (GRCm39) P607S probably damaging Het
Ranbp9 G A 13: 43,566,015 (GRCm39) R424C probably damaging Het
Rsl1 G A 13: 67,325,229 (GRCm39) probably benign Het
Setd3 A T 12: 108,079,603 (GRCm39) L300Q possibly damaging Het
Slc15a3 T C 19: 10,834,595 (GRCm39) I492T possibly damaging Het
Stag1 T C 9: 100,762,953 (GRCm39) probably benign Het
Tgm4 A G 9: 122,880,481 (GRCm39) Y294C probably damaging Het
Tm9sf1 A G 14: 55,878,757 (GRCm39) S212P probably benign Het
Tmcc1 A G 6: 116,110,826 (GRCm39) S156P probably damaging Het
Vmn1r184 A C 7: 25,966,670 (GRCm39) M139L probably benign Het
Vmn1r209 A C 13: 22,990,652 (GRCm39) F13V possibly damaging Het
Xkr5 T C 8: 18,984,141 (GRCm39) E467G probably benign Het
Zdbf2 C T 1: 63,348,131 (GRCm39) S2170L possibly damaging Het
Zfp277 G T 12: 40,379,609 (GRCm39) probably null Het
Zfp62 T C 11: 49,106,596 (GRCm39) I229T probably damaging Het
Zfp810 A G 9: 22,190,324 (GRCm39) S195P possibly damaging Het
Zfp94 G A 7: 24,010,927 (GRCm39) probably benign Het
Other mutations in Sema4c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Sema4c APN 1 36,593,001 (GRCm39) critical splice donor site probably benign 0.00
IGL01824:Sema4c APN 1 36,592,110 (GRCm39) missense possibly damaging 0.76
IGL02236:Sema4c APN 1 36,592,166 (GRCm39) missense probably damaging 1.00
IGL02262:Sema4c APN 1 36,589,422 (GRCm39) missense probably damaging 1.00
IGL02282:Sema4c APN 1 36,589,284 (GRCm39) splice site probably null
IGL02476:Sema4c APN 1 36,595,031 (GRCm39) missense probably damaging 0.98
IGL02900:Sema4c APN 1 36,589,826 (GRCm39) nonsense probably null
swirl UTSW 1 36,589,392 (GRCm39) missense probably damaging 1.00
IGL02837:Sema4c UTSW 1 36,591,965 (GRCm39) missense probably damaging 1.00
R0427:Sema4c UTSW 1 36,592,892 (GRCm39) nonsense probably null
R0497:Sema4c UTSW 1 36,588,689 (GRCm39) missense probably benign 0.04
R1066:Sema4c UTSW 1 36,589,281 (GRCm39) missense possibly damaging 0.95
R1099:Sema4c UTSW 1 36,591,191 (GRCm39) missense probably damaging 1.00
R1146:Sema4c UTSW 1 36,589,646 (GRCm39) missense probably benign 0.04
R1146:Sema4c UTSW 1 36,589,646 (GRCm39) missense probably benign 0.04
R1639:Sema4c UTSW 1 36,592,615 (GRCm39) missense probably benign 0.00
R3176:Sema4c UTSW 1 36,588,960 (GRCm39) missense possibly damaging 0.65
R3177:Sema4c UTSW 1 36,588,960 (GRCm39) missense possibly damaging 0.65
R3276:Sema4c UTSW 1 36,588,960 (GRCm39) missense possibly damaging 0.65
R3277:Sema4c UTSW 1 36,588,960 (GRCm39) missense possibly damaging 0.65
R3551:Sema4c UTSW 1 36,592,804 (GRCm39) missense probably benign 0.02
R4452:Sema4c UTSW 1 36,592,837 (GRCm39) missense probably benign 0.31
R4883:Sema4c UTSW 1 36,591,097 (GRCm39) missense probably damaging 0.98
R4895:Sema4c UTSW 1 36,592,651 (GRCm39) splice site probably null
R4913:Sema4c UTSW 1 36,589,266 (GRCm39) missense probably benign 0.11
R4944:Sema4c UTSW 1 36,589,392 (GRCm39) missense probably damaging 1.00
R5062:Sema4c UTSW 1 36,592,059 (GRCm39) critical splice donor site probably null
R5077:Sema4c UTSW 1 36,590,812 (GRCm39) missense probably benign 0.20
R5109:Sema4c UTSW 1 36,591,381 (GRCm39) frame shift probably null
R5208:Sema4c UTSW 1 36,589,407 (GRCm39) missense probably damaging 1.00
R5551:Sema4c UTSW 1 36,591,398 (GRCm39) missense probably damaging 1.00
R5912:Sema4c UTSW 1 36,593,469 (GRCm39) missense possibly damaging 0.83
R6578:Sema4c UTSW 1 36,589,834 (GRCm39) missense probably benign 0.02
R7111:Sema4c UTSW 1 36,592,160 (GRCm39) missense possibly damaging 0.48
R7141:Sema4c UTSW 1 36,592,101 (GRCm39) missense probably damaging 0.99
R7252:Sema4c UTSW 1 36,589,096 (GRCm39) missense probably damaging 1.00
R7495:Sema4c UTSW 1 36,589,774 (GRCm39) missense probably benign 0.00
R7891:Sema4c UTSW 1 36,588,995 (GRCm39) missense probably damaging 0.98
R7895:Sema4c UTSW 1 36,592,199 (GRCm39) missense probably damaging 1.00
R8264:Sema4c UTSW 1 36,591,966 (GRCm39) missense probably damaging 1.00
R8478:Sema4c UTSW 1 36,590,871 (GRCm39) missense probably benign 0.04
R8680:Sema4c UTSW 1 36,589,867 (GRCm39) missense probably benign 0.00
R8733:Sema4c UTSW 1 36,591,954 (GRCm39) missense probably damaging 1.00
R9017:Sema4c UTSW 1 36,592,079 (GRCm39) missense probably damaging 1.00
R9344:Sema4c UTSW 1 36,592,395 (GRCm39) missense probably damaging 1.00
R9488:Sema4c UTSW 1 36,591,067 (GRCm39) missense probably benign
X0019:Sema4c UTSW 1 36,592,077 (GRCm39) missense probably damaging 1.00
X0028:Sema4c UTSW 1 36,589,047 (GRCm39) missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GAAGTGGCATCAGAGATCCAACTCC -3'
(R):5'- AAACTGAGTTTCCTGGCCCGAGTG -3'

Sequencing Primer
(F):5'- GAGATCCAACTCCAATCACCTTAG -3'
(R):5'- GTCCCTGTCTAAGAAGGTCATGTC -3'
Posted On 2014-04-24